Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0004018.1

Orthogroup ID

OG0002803

Physical Location & Seq

Genomic Coordinates Forward (+)

23908 .. 24225

Gene Structure 318 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0004018.1_g000009.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 318 bp

atggcagagttgttgggtcattattctctaagcaaactcacgtttggttcgatcacaaagggaagaccaaagaggattcagaaacacagttggaggccaattgggtgtgtgttaactgaagataacagacgagttgtggttaagaatgggaaggattcattagacatatgtagggttgtgaatgggatgtggcagaccagcgaaggctggggtcgaattgatagagacaatgctgttgatgctatgcttaaatatgctgatgccggactcactacatttgatatggcagatatatgtatagcactcgattttcagtaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Aldo_ket_red

Protein Analysis

105

Amino Acids

11.82

Weight (kDa)

8.52

Isoelectric Point (pI)

30.4

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002803)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G27680
fragaria_vesca	FvH4_3g29620 FvH4_3g29620 FvH4_3g29620 FvH4_3g29620 FvH4_3g29620 FvH4_3g29620 FvH4_3g29620
malus_domestica	MD03G1139700.v1.1 MD11G1162100.v1.1
prunus_persica	Prupe.6G124700_v2.0.a1 Prupe.6G124700_v2.0.a1 Prupe.6G124700_v2.0.a1
pyrus_communis	pycom03g09470 pycom11g13190
rosa_chinensis	RchiOBHm_Chr5g0054671 RchiOBHm_Chr5g0054681 RchiOBHm_Chr5g0054781 RchiOBHm_Chr5g0054911
rosa_laevigata	RLG00000034944
rosa_multiflora	Rmu_sc0001552.1_g000054 Rmu_sc0002028.1_g000015 Rmu_sc0002371.1_g000026 Rmu_sc0004018.1_g000009 Rmu_sc0012706.1_g000003
rosa_roxburghii	Rroxscaffold_1G00025640 Rroxscaffold_1G00025800 Rroxscaffold_1G00026090 Rroxscaffold_1G00026220
rosa_rugosa	Rorug05G0287800 Rorug05G0288300 Rorug05G0289300 Rorug05G0289400
rosa_samantha	Rh5AG358700 Rh5AG359100 Rh5BG369900 Rh5CG392500 Rh5DG383500
rosa_wichuraiana	Rw5G033810

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcuI	CTGAAG	1 cut(s)	138
Alw26I	GTCTC	1 cut(s)	219
AoxI	GGCC	1 cut(s)	95
BbsI	GAAGAC	1 cut(s)	70
BcoDI	GTCTC	1 cut(s)	219
BmsI	GCATC	2 cut(s)	229, 250
BpiI	GAAGAC	1 cut(s)	70
BseGI	GGATG	1 cut(s)	192
BseYI	CCCAGC	1 cut(s)	207
BshFI	GGCC	1 cut(s)	97
BsiSI	CCGG	1 cut(s)	264
BsmAI	GTCTC	1 cut(s)	219
BsnI	GGCC	1 cut(s)	97
Bsp143I	GATC	1 cut(s)	51
BspANI	GGCC	1 cut(s)	97
BssMI	GATC	1 cut(s)	51
Bst4CI	ACNGT	1 cut(s)	89
BstDEI	CTNAG	1 cut(s)	29
BstF5I	GGATG	1 cut(s)	192
BstKTI	GATC	1 cut(s)	54
BstMAI	GTCTC	1 cut(s)	219
BstMBI	GATC	1 cut(s)	51
BstMWI	GCNNNNNNNGC	1 cut(s)	239
BstV2I	GAAGAC	1 cut(s)	70
BsuRI	GGCC	1 cut(s)	97
BtsCI	GGATG	1 cut(s)	192
CviJI	RGCY	2 cut(s)	97, 207
CviKI_1	RGCY	2 cut(s)	97, 207
DdeI	CTNAG	1 cut(s)	29
DpnI	GATC	1 cut(s)	53
DpnII	GATC	1 cut(s)	51
Eco57I	CTGAAG	1 cut(s)	138
FaiI	YATR	8 cut(s)	167, 169, 245, 255, 284, 293, 295, 299
FauNDI	CATATG	1 cut(s)	167
FokI	GGATG	1 cut(s)	199
GsaI	CCCAGC	1 cut(s)	211
HaeIII	GGCC	1 cut(s)	97
HapII	CCGG	1 cut(s)	264
HincII	GTYRAC	1 cut(s)	114
HindII	GTYRAC	1 cut(s)	114
HinfI	GANTC	3 cut(s)	76, 155, 267
HpaI	GTTAAC	1 cut(s)	114
HpaII	CCGG	1 cut(s)	264
Hpy166II	GTNNAC	1 cut(s)	114
Hpy188I	TCNGA	1 cut(s)	81
Hpy8I	GTNNAC	1 cut(s)	114
HpyAV	CCTTC	2 cut(s)	145, 197
HpyCH4III	ACNGT	1 cut(s)	89
HpyCH4IV	ACGT	1 cut(s)	41
HpyF10VI	GCNNNNNNNGC	1 cut(s)	239
HpyF3I	CTNAG	1 cut(s)	29
HpySE526I	ACGT	1 cut(s)	41
KspAI	GTTAAC	1 cut(s)	114
Kzo9I	GATC	1 cut(s)	51
LpnPI	CCDG	3 cut(s)	193, 211, 277
LweI	GCATC	2 cut(s)	229, 250
MaeII	ACGT	1 cut(s)	41
MalI	GATC	1 cut(s)	53
MboI	GATC	1 cut(s)	51
MboII	GAAGA	2 cut(s)	75, 131
MfeI	CAATTG	1 cut(s)	99
MluCI	AATT	2 cut(s)	99, 216
MlyI	GAGTC	1 cut(s)	261
MmeI	TCCRAC	1 cut(s)	71
MnlI	CCTC	2 cut(s)	66, 87
MseI	TTAA	3 cut(s)	113, 141, 249
MspI	CCGG	1 cut(s)	264
MunI	CAATTG	1 cut(s)	99
MwoI	GCNNNNNNNGC	1 cut(s)	239
NdeI	CATATG	1 cut(s)	167
NdeII	GATC	1 cut(s)	51
PcsI	WCGNNNNNNNCGW	1 cut(s)	47
PfeI	GAWTC	2 cut(s)	76, 155
PleI	GAGTC	1 cut(s)	261
PpsI	GAGTC	1 cut(s)	261
PspFI	CCCAGC	1 cut(s)	207
SaqAI	TTAA	3 cut(s)	113, 141, 249
Sau3AI	GATC	1 cut(s)	51
SchI	GAGTC	1 cut(s)	261
SetI	ASST	1 cut(s)	44
SfaNI	GCATC	2 cut(s)	229, 250
SgeI	CNNG	5 cut(s)	52, 143, 210, 220, 276
Sse9I	AATT	2 cut(s)	99, 216
TaaI	ACNGT	1 cut(s)	89
TaiI	ACGT	1 cut(s)	44
TaqI	TCGA	3 cut(s)	50, 214, 306
TasI	AATT	2 cut(s)	99, 216
TfiI	GAWTC	2 cut(s)	76, 155
Tru1I	TTAA	3 cut(s)	113, 141, 249
Tru9I	TTAA	3 cut(s)	113, 141, 249
TspDTI	ATGAA	1 cut(s)	147

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.