Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0004193.1

Orthogroup ID

OG0002429

Physical Location & Seq

Genomic Coordinates Forward (+)

27290 .. 28587

Gene Structure 1298 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0004193.1_g000008.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 474 bp

atggagaatatacttgaacgctatgagcggtactcgtacgcagagagacagctagtcgaacctgatttggaatcacagggtaactggaccttcgaacatgctagactgaaggtgaaagttgagcttctgcaaagaaaccttaggcactatttgggagaagatctggattcattgagtatcaaagagatccaaagtttggagcaacagcttgacaattctcttaagcaaattcgatcaagaaagattaaggagaaagagaagaatgtagcggaagctcaggaggttcataattgggagcagcagcaactgcagcaaaaccatggccttaacctggtagcacaggctccacttccatgtttgaacatggggggcactcagcaaaatgatcagttccttcaagtgaggaggaaccagctcgaccttactctcgagccatcgttgtattcatgccaccttggatgctttgcttcatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

K-box SRF-TF

Protein Analysis

157

Amino Acids

18.45

Weight (kDa)

5.56

Isoelectric Point (pI)

59.0

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002429)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G26310 AT1G69120 AT1G69120 AT1G69120
fragaria_vesca	FvH4_4g29600 FvH4_4g29600 FvH4_4g29600 FvH4_4g29600 FvH4_6g46410
malus_domestica	MD09G1074100.v1.1 MD13G1059200.v1.1 MD16G1058500.v1.1 MD17G1065500.v1.1
prunus_persica	Prupe.1G290600_v2.0.a1 Prupe.3G249300_v2.0.a1 Prupe.3G249300_v2.0.a1 Prupe.3G249300_v2.0.a1
pyrus_communis	pycom16g05110 pycom17g06540
rosa_chinensis	RchiOBHm_Chr2g0164941 RchiOBHm_Chr4g0437841
rosa_laevigata	RLG00000006408 RLG00000021499
rosa_multiflora	Rmu_sc0001097.1_g000003 Rmu_sc0004193.1_g000008
rosa_roxburghii	Rroxscaffold_2G00086190 Rroxscaffold_5G00379010
rosa_rugosa	Rorug02G0511400 Rorug04G0304200 Rorug04G0304300 Rorug04G0304300 Rorug04G0304400
rosa_samantha	Rh2AG579700 Rh2BG590700 Rh2CG561400 Rh2DG601100 Rh4AG356500 Rh4CG381400 Rh4DG361700
rosa_wichuraiana	Rw2G048120 Rw4G031440

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	196
AccBSI	CCGCTC	1 cut(s)	28
AciI	CCGC	2 cut(s)	28, 269
AclWI	GGATC	1 cut(s)	181
AcsI	RAATTY	1 cut(s)	228
AcuI	CTGAAG	1 cut(s)	128
AfaI	GTAC	2 cut(s)	32, 38
AfiI	CCNNNNNNNGG	2 cut(s)	196, 331
AflII	CTTAAG	1 cut(s)	221
AgsI	TTSAA	3 cut(s)	17, 361, 398
AhdI	GACNNNNNGTC	1 cut(s)	53
AjnI	CCWGG	1 cut(s)	330
AluBI	AGCT	5 cut(s)	52, 124, 208, 275, 415
AluI	AGCT	5 cut(s)	52, 124, 208, 275, 415
Alw26I	GTCTC	1 cut(s)	40
AlwI	GGATC	1 cut(s)	181
AlwNI	CAGNNNCTG	1 cut(s)	307
Ama87I	CYCGRG	1 cut(s)	428
AoxI	GGCC	1 cut(s)	322
ApeKI	GCWGC	3 cut(s)	298, 301, 310
ApoI	RAATTY	1 cut(s)	228
AspS9I	GGNCC	1 cut(s)	87
AsuHPI	GGTGA	1 cut(s)	124
AsuII	TTCGAA	1 cut(s)	93
AvaI	CYCGRG	1 cut(s)	428
AvaII	GGWCC	1 cut(s)	87
AxyI	CCTNAGG	1 cut(s)	140
BaeGI	GKGCMC	1 cut(s)	374
BbvI	GCAGC	3 cut(s)	310, 313, 322
BccI	CCATC	1 cut(s)	442
BciT130I	CCWGG	1 cut(s)	332
BclI	TGATCA	1 cut(s)	385
BcoDI	GTCTC	1 cut(s)	40
BfaI	CTAG	2 cut(s)	53, 102
BfmI	CTRYAG	1 cut(s)	308
BfrI	CTTAAG	1 cut(s)	221
BglII	AGATCT	1 cut(s)	160
BisI	GCNGC	3 cut(s)	299, 302, 311
BlsI	GCNGC	3 cut(s)	300, 303, 312
Bme1390I	CCNGG	1 cut(s)	332
Bme18I	GGWCC	1 cut(s)	87
BmeRI	GACNNNNNGTC	1 cut(s)	53
BmeT110I	CYCGRG	1 cut(s)	428
BmgT120I	GGNCC	1 cut(s)	87
BmiI	GGNNCC	2 cut(s)	345, 410
BmrFI	CCNGG	1 cut(s)	332
BmsI	GCATC	1 cut(s)	449
BplI	GAGNNNNNCTC	2 cut(s)	17, 49
Bpu10I	CCTNAGC	1 cut(s)	276
Bpu14I	TTCGAA	1 cut(s)	93
BsaJI	CCNNGG	2 cut(s)	319, 454
Bsc4I	CCNNNNNNNGG	2 cut(s)	196, 331
Bse1I	ACTGG	1 cut(s)	89
Bse21I	CCTNAGG	1 cut(s)	140
BseBI	CCWGG	1 cut(s)	332
BseDI	CCNNGG	2 cut(s)	319, 454
BseGI	GGATG	1 cut(s)	464
BseLI	CCNNNNNNNGG	2 cut(s)	196, 331
BseMII	CTCAG	2 cut(s)	290, 389
BseNI	ACTGG	1 cut(s)	89
BseRI	GAGGAG	1 cut(s)	418
BseSI	GKGCMC	1 cut(s)	374
BseXI	GCAGC	3 cut(s)	310, 313, 322
BshFI	GGCC	1 cut(s)	324
BsiHKCI	CYCGRG	1 cut(s)	428
BsiWI	CGTACG	1 cut(s)	36
BslI	CCNNNNNNNGG	2 cut(s)	196, 331
BsmAI	GTCTC	1 cut(s)	40
BsnI	GGCC	1 cut(s)	324
BsoBI	CYCGRG	1 cut(s)	428
Bsp119I	TTCGAA	1 cut(s)	93
Bsp1286I	GDGCHC	1 cut(s)	374
Bsp143I	GATC	4 cut(s)	160, 186, 233, 385
Bsp19I	CCATGG	1 cut(s)	319
BspACI	CCGC	2 cut(s)	28, 269
BspANI	GGCC	1 cut(s)	324
BspCNI	CTCAG	2 cut(s)	289, 388
BspHI	TCATGA	1 cut(s)	470
BspLI	GGNNCC	2 cut(s)	345, 410
BspMAI	CTGCAG	1 cut(s)	312
BspPI	GGATC	1 cut(s)	181
BspT104I	TTCGAA	1 cut(s)	93
BspTI	CTTAAG	1 cut(s)	221
BsrBI	CCGCTC	1 cut(s)	28
BsrI	ACTGG	1 cut(s)	89
BssECI	CCNNGG	2 cut(s)	319, 454
BssMI	GATC	4 cut(s)	160, 186, 233, 385
BssT1I	CCWWGG	2 cut(s)	319, 454
Bst2UI	CCWGG	1 cut(s)	332
BstAFI	CTTAAG	1 cut(s)	221
BstAPI	GCANNNNNTGC	1 cut(s)	307
BstBI	TTCGAA	1 cut(s)	93
BstDEI	CTNAG	3 cut(s)	140, 276, 375
BstDSI	CCRYGG	1 cut(s)	319
BstF5I	GGATG	1 cut(s)	464
BstKTI	GATC	4 cut(s)	163, 189, 236, 388
BstMAI	GTCTC	1 cut(s)	40
BstMBI	GATC	4 cut(s)	160, 186, 233, 385
BstMWI	GCNNNNNNNGC	2 cut(s)	307, 310
BstNI	CCWGG	1 cut(s)	332
BstNSI	RCATGY	1 cut(s)	101
BstSCI	CCNGG	1 cut(s)	330
BstSFI	CTRYAG	1 cut(s)	308
BstSLI	GKGCMC	1 cut(s)	374
BstV1I	GCAGC	3 cut(s)	310, 313, 322
BstX2I	RGATCY	2 cut(s)	160, 186
BstYI	RGATCY	2 cut(s)	160, 186
Bsu36I	CCTNAGG	1 cut(s)	140
BsuRI	GGCC	1 cut(s)	324
BtgI	CCRYGG	1 cut(s)	319
BtsCI	GGATG	1 cut(s)	464
CaiI	CAGNNNCTG	1 cut(s)	307
CciI	TCATGA	1 cut(s)	470
Cfr13I	GGNCC	1 cut(s)	87
CsiI	ACCWGGT	1 cut(s)	330
Csp6I	GTAC	2 cut(s)	31, 37
CviAII	CATG	6 cut(s)	98, 320, 354, 364, 447, 471
CviJI	RGCY	8 cut(s)	52, 124, 208, 275, 324, 344, 415, 433
CviKI_1	RGCY	8 cut(s)	52, 124, 208, 275, 324, 344, 415, 433
CviQI	GTAC	2 cut(s)	31, 37
DdeI	CTNAG	3 cut(s)	140, 276, 375
DpnI	GATC	4 cut(s)	162, 188, 235, 387
DpnII	GATC	4 cut(s)	160, 186, 233, 385
DriI	GACNNNNNGTC	1 cut(s)	53
Eam1105I	GACNNNNNGTC	1 cut(s)	53
Eco130I	CCWWGG	2 cut(s)	319, 454
Eco47I	GGWCC	1 cut(s)	87
Eco57I	CTGAAG	1 cut(s)	128
Eco81I	CCTNAGG	1 cut(s)	140
Eco88I	CYCGRG	1 cut(s)	428
EcoRII	CCWGG	1 cut(s)	330
EcoT14I	CCWWGG	2 cut(s)	319, 454
ErhI	CCWWGG	2 cut(s)	319, 454
FaeI	CATG	6 cut(s)	101, 323, 357, 367, 450, 474
FaiI	YATR	9 cut(s)	11, 24, 99, 288, 321, 355, 365, 448, 472
FalI	AAGNNNNNCTT	2 cut(s)	108, 140
FatI	CATG	6 cut(s)	97, 319, 353, 363, 446, 470
FbaI	TGATCA	1 cut(s)	385
Fnu4HI	GCNGC	3 cut(s)	299, 302, 311
Fsp4HI	GCNGC	3 cut(s)	299, 302, 311
FspBI	CTAG	2 cut(s)	53, 102
GluI	GCNGC	3 cut(s)	299, 302, 311
HaeIII	GGCC	1 cut(s)	324
Hin1II	CATG	6 cut(s)	101, 323, 357, 367, 450, 474
HinfI	GANTC	2 cut(s)	71, 167
HphI	GGTGA	1 cut(s)	124
Hpy188III	TCNNGA	5 cut(s)	164, 237, 278, 428, 471
HpyAV	CCTTC	3 cut(s)	100, 103, 404
HpyCH4V	TGCA	2 cut(s)	130, 310
HpyF10VI	GCNNNNNNNGC	2 cut(s)	307, 310
HpyF3I	CTNAG	3 cut(s)	140, 276, 375
Hsp92II	CATG	6 cut(s)	101, 323, 357, 367, 450, 474
Ksp22I	TGATCA	1 cut(s)	385
Kzo9I	GATC	4 cut(s)	160, 186, 233, 385
LmnI	GCTCC	3 cut(s)	199, 295, 349
LpnPI	CCDG	9 cut(s)	62, 70, 75, 149, 263, 317, 326, 344, 425
Lsp1109I	GCAGC	3 cut(s)	310, 313, 322
LweI	GCATC	1 cut(s)	449
MabI	ACCWGGT	1 cut(s)	330
MaeI	CTAG	2 cut(s)	53, 102
MaeIII	GTNAC	1 cut(s)	80
MalI	GATC	4 cut(s)	162, 188, 235, 387
MbiI	CCGCTC	1 cut(s)	28
MboI	GATC	4 cut(s)	160, 186, 233, 385
MboII	GAAGA	2 cut(s)	170, 271
MflI	RGATCY	2 cut(s)	160, 186
MhlI	GDGCHC	1 cut(s)	374
MluCI	AATT	3 cut(s)	214, 228, 289
MnlI	CCTC	3 cut(s)	274, 396, 399
MseI	TTAA	3 cut(s)	222, 246, 327
MslI	CAYNNNNRTG	1 cut(s)	352
MspCI	CTTAAG	1 cut(s)	221
MspR9I	CCNGG	1 cut(s)	332
MvaI	CCWGG	1 cut(s)	332
MwoI	GCNNNNNNNGC	2 cut(s)	307, 310
NcoI	CCATGG	1 cut(s)	319
NdeII	GATC	4 cut(s)	160, 186, 233, 385
NlaIII	CATG	6 cut(s)	101, 323, 357, 367, 450, 474
NlaIV	GGNNCC	2 cut(s)	345, 410
NspI	RCATGY	1 cut(s)	101
NspV	TTCGAA	1 cut(s)	93
PaeR7I	CTCGAG	1 cut(s)	428
PagI	TCATGA	1 cut(s)	470
PfeI	GAWTC	2 cut(s)	71, 167
Pfl23II	CGTACG	1 cut(s)	36
PflMI	CCANNNNNTGG	1 cut(s)	196
PkrI	GCNGC	3 cut(s)	300, 303, 312
Psp6I	CCWGG	1 cut(s)	330
PspGI	CCWGG	1 cut(s)	330
PspLI	CGTACG	1 cut(s)	36
PspN4I	GGNNCC	2 cut(s)	345, 410
PspPI	GGNCC	1 cut(s)	87
PstI	CTGCAG	1 cut(s)	312
PstNI	CAGNNNCTG	1 cut(s)	307
PsuI	RGATCY	2 cut(s)	160, 186
RsaI	GTAC	2 cut(s)	32, 38
RsaNI	GTAC	2 cut(s)	31, 37
RseI	CAYNNNNRTG	1 cut(s)	352
SaqAI	TTAA	3 cut(s)	222, 246, 327
SatI	GCNGC	3 cut(s)	299, 302, 311
Sau3AI	GATC	4 cut(s)	160, 186, 233, 385
Sau96I	GGNCC	1 cut(s)	87
ScrFI	CCNGG	1 cut(s)	332
SduI	GDGCHC	1 cut(s)	374
SexAI	ACCWGGT	1 cut(s)	330
SfaNI	GCATC	1 cut(s)	449
SfcI	CTRYAG	1 cut(s)	308
Sfr274I	CTCGAG	1 cut(s)	428
SfuI	TTCGAA	1 cut(s)	93
SinI	GGWCC	1 cut(s)	87
SlaI	CTCGAG	1 cut(s)	428
SmiMI	CAYNNNNRTG	1 cut(s)	352
SmlI	CTYRAG	2 cut(s)	221, 428
SmoI	CTYRAG	2 cut(s)	221, 428
Sse9I	AATT	3 cut(s)	214, 228, 289
SsiI	CCGC	2 cut(s)	28, 269
SspMI	CTAG	2 cut(s)	53, 102
StyD4I	CCNGG	1 cut(s)	330
StyI	CCWWGG	2 cut(s)	319, 454
TaqI	TCGA	5 cut(s)	57, 93, 232, 417, 429
TasI	AATT	3 cut(s)	214, 228, 289
TfiI	GAWTC	2 cut(s)	71, 167
Tru1I	TTAA	3 cut(s)	222, 246, 327
Tru9I	TTAA	3 cut(s)	222, 246, 327
TseI	GCWGC	3 cut(s)	298, 301, 310
TspDTI	ATGAA	4 cut(s)	159, 275, 435, 459
Van91I	CCANNNNNTGG	1 cut(s)	196
Vha464I	CTTAAG	1 cut(s)	221
VpaK11BI	GGWCC	1 cut(s)	87
XapI	RAATTY	1 cut(s)	228
XceI	RCATGY	1 cut(s)	101
XhoI	CTCGAG	1 cut(s)	428
XspI	CTAG	2 cut(s)	53, 102

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.