Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0004926.1

Orthogroup ID

OG0000702

Physical Location & Seq

Genomic Coordinates Reverse (-)

44913 .. 45760

Gene Structure 848 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0004926.1_g000013.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 636 bp

atgcaaggggttaaagtatcggcctccggcaacagccctaacaccgacggtatccatgttcaaatgtcatcgggtgttaccattctcaactcaaagatctctactggtgatgactgcgtatcaattggtcccggcacttctaacttgtggattgaaaatgttgcatgcggaccgggtcatggaattagcattgggagtctaggcaaagatctacaggaagctggtgtgcaaaatgtaacggtgaaaacagtgacatttaccaatactcaaaatggtgtgagaatcaagtcctgggggagggctagcactggatttgccaggaacattcttttccaacatgctgtcatgattaacgttcaaaatccgatcgtcatcgatcaacaatattgtcccgacaaaaaaggctgccctggccaggtttctggagttaaaatcagtgatgtgacatatcaagacattcatggcacatcggcaacagaagttgcagtgaaattcgattgtagttcaaagtacccatgtagcagaatcagattggagaatgtgaagctcacatacaagaaccaaggagctctagcttcttgtagcaatgctggtggaacatctgcgggtatggtgctgcctacaagttgtctatag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005576 GO:0005618 GO:0005623 GO:0030312 GO:0044464 GO:0071944

KEGG Pathways

Metabolic & Signaling

ko00040 ko01100 map00040 map01100

Pfam Domains

Protein Families

Glyco_hydro_28

Protein Analysis

211

Amino Acids

22.07

Weight (kDa)

8.63

Isoelectric Point (pI)

25.85

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000702)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G43870 AT3G59850 AT3G59850
fragaria_vesca	FvH4_1g00290 FvH4_1g00290 FvH4_1g21842 FvH4_1g21850 FvH4_1g21851
malus_domestica	MD00G1070500.v1.1 MD00G1087900.v1.1
prunus_persica	Prupe.4G261700_v2.0.a1 Prupe.4G261800_v2.0.a1 Prupe.4G261900_v2.0.a1 Prupe.4G262200_v2.0.a1 Prupe.4G262200_v2.0.a1 Prupe.7G269200_v2.0.a1
pyrus_communis	pycom02g00030 pycom03g19680
rosa_chinensis	RchiOBHm_Chr2g0084591 RchiOBHm_Chr2g0085391 RchiOBHm_Chr2g0115741 RchiOBHm_Chr2g0115771 RchiOBHm_Chr2g0115801 RchiOBHm_Chr2g0115811 RchiOBHm_Chr2g0115821 RchiOBHm_Chr5g0021021 RchiOBHm_Chr5g0021031
rosa_laevigata	RLG00000015683 RLG00000018208 RLG00000018211 RLG00000018212
rosa_multiflora	Rmu_co8137638.1_g000001 Rmu_sc0000742.1_g000006 Rmu_sc0004926.1_g000013 Rmu_sc0008355.1_g000010 Rmu_sc0011452.1_g000015 Rmu_ssc0000197.1_g000031 Rmu_ssc0000197.1_g000032 Rmu_ssc0000197.1_g000056
rosa_roxburghii	Rroxscaffold_2G00127770 Rroxscaffold_2G00127780 Rroxscaffold_2G00127790 Rroxscaffold_2G00127830 Rroxscaffold_2G00127850 Rroxscaffold_2G00128630 Rroxscaffold_2G00128640 Rroxscaffold_2G00128680 Rroxscaffold_2G00128730 Rroxscaffold_2G00128740
rosa_rugosa	Rorug01G0455200 Rorug01G0460100 Rorug02G0199800 Rorug02G0199900
rosa_samantha	Rh2BG003000 Rh2BG267500 Rh2BG267700 Rh2BG267800 Rh2BG267900 Rh2CG003400 Rh2CG010000 Rh2CG262800 Rh2CG263200 Rh2CG263300 Rh2CG263400 Rh5CG165700 Rh5CG165800
rosa_wichuraiana	Rw0G014320 Rw0G014330 Rw1G010220 Rw2G000800 Rw2G020110 Rw2G020130 Rw2G020150 Rw2G020160

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	2 cut(s)	168, 605
AclI	AACGTT	1 cut(s)	354
AcoI	YGGCCR	1 cut(s)	412
AcsI	RAATTY	1 cut(s)	491
AfaI	GTAC	1 cut(s)	512
AfiI	CCNNNNNNNGG	3 cut(s)	179, 297, 415
AgsI	TTSAA	4 cut(s)	62, 155, 359, 507
AjnI	CCWGG	4 cut(s)	290, 317, 409, 414
AluBI	AGCT	4 cut(s)	221, 547, 569, 575
AluI	AGCT	4 cut(s)	221, 547, 569, 575
Alw21I	GWGCWC	1 cut(s)	571
AoxI	GGCC	2 cut(s)	21, 412
ApeKI	GCWGC	2 cut(s)	405, 616
ApoI	RAATTY	1 cut(s)	491
AspS9I	GGNCC	2 cut(s)	128, 170
AsuC2I	CCSGG	2 cut(s)	132, 174
AsuHPI	GGTGA	2 cut(s)	119, 253
AsuNHI	GCTAGC	1 cut(s)	302
AvaII	GGWCC	2 cut(s)	128, 170
BalI	TGGCCA	1 cut(s)	414
BanII	GRGCYC	1 cut(s)	571
BarI	GAAGNNNNNNTAC	2 cut(s)	536, 568
Bbv12I	GWGCWC	1 cut(s)	571
BbvI	GCAGC	2 cut(s)	392, 603
BciT130I	CCWGG	4 cut(s)	292, 319, 411, 416
BciVI	GTATCC	1 cut(s)	62
BcnI	CCSGG	2 cut(s)	132, 174
BfaI	CTAG	3 cut(s)	200, 303, 572
BfmI	CTRYAG	2 cut(s)	212, 632
BfuI	GTATCC	1 cut(s)	62
BglII	AGATCT	2 cut(s)	96, 208
BisI	GCNGC	2 cut(s)	406, 617
BlsI	GCNGC	2 cut(s)	407, 618
Bme1390I	CCNGG	6 cut(s)	132, 174, 292, 319, 411, 416
Bme18I	GGWCC	2 cut(s)	128, 170
BmgT120I	GGNCC	2 cut(s)	128, 170
BmiI	GGNNCC	1 cut(s)	130
BmrFI	CCNGG	6 cut(s)	132, 174, 292, 319, 411, 416
BmtI	GCTAGC	1 cut(s)	306
BpmI	CTGGAG	1 cut(s)	444
BpuMI	CCSGG	2 cut(s)	132, 174
Bsa29I	ATCGAT	1 cut(s)	375
BsaBI	GATNNNNATC	1 cut(s)	371
BsaJI	CCNNGG	3 cut(s)	291, 409, 562
Bsc4I	CCNNNNNNNGG	3 cut(s)	179, 297, 415
Bse1I	ACTGG	2 cut(s)	109, 313
Bse3DI	GCAATG	1 cut(s)	592
Bse8I	GATNNNNATC	1 cut(s)	371
BseBI	CCWGG	4 cut(s)	292, 319, 411, 416
BseCI	ATCGAT	1 cut(s)	375
BseDI	CCNNGG	3 cut(s)	291, 409, 562
BseJI	GATNNNNATC	1 cut(s)	371
BseLI	CCNNNNNNNGG	3 cut(s)	179, 297, 415
BseMI	GCAATG	1 cut(s)	592
BseNI	ACTGG	2 cut(s)	109, 313
BseXI	GCAGC	2 cut(s)	392, 603
Bsh1285I	CGRYCG	1 cut(s)	369
BshFI	GGCC	2 cut(s)	23, 414
BshVI	ATCGAT	1 cut(s)	375
BsiEI	CGRYCG	1 cut(s)	369
BsiHKAI	GWGCWC	1 cut(s)	571
BsiSI	CCGG	3 cut(s)	27, 132, 173
BslFI	GGGAC	2 cut(s)	114, 375
BslI	CCNNNNNNNGG	3 cut(s)	179, 297, 415
BsmFI	GGGAC	2 cut(s)	114, 375
BsnI	GGCC	2 cut(s)	23, 414
Bsp1286I	GDGCHC	1 cut(s)	571
Bsp143I	GATC	4 cut(s)	96, 208, 366, 376
BspACI	CCGC	2 cut(s)	168, 605
BspANI	GGCC	2 cut(s)	23, 414
BspDI	ATCGAT	1 cut(s)	375
BspHI	TCATGA	1 cut(s)	345
BspLI	GGNNCC	1 cut(s)	130
BspOI	GCTAGC	1 cut(s)	306
BsrDI	GCAATG	1 cut(s)	592
BsrI	ACTGG	2 cut(s)	109, 313
BssECI	CCNNGG	3 cut(s)	291, 409, 562
BssMI	GATC	4 cut(s)	96, 208, 366, 376
BssT1I	CCWWGG	1 cut(s)	562
Bst2UI	CCWGG	4 cut(s)	292, 319, 411, 416
Bst4CI	ACNGT	3 cut(s)	50, 241, 250
BstC8I	GCNNGC	2 cut(s)	166, 304
BstENI	CCTNNNNNAGG	1 cut(s)	295
BstKTI	GATC	4 cut(s)	99, 211, 369, 379
BstMBI	GATC	4 cut(s)	96, 208, 366, 376
BstMCI	CGRYCG	1 cut(s)	369
BstMWI	GCNNNNNNNGC	1 cut(s)	411
BstNI	CCWGG	4 cut(s)	292, 319, 411, 416
BstNSI	RCATGY	2 cut(s)	168, 341
BstSCI	CCNGG	6 cut(s)	130, 172, 290, 317, 409, 414
BstSFI	CTRYAG	2 cut(s)	212, 632
BstV1I	GCAGC	2 cut(s)	392, 603
BstX2I	RGATCY	2 cut(s)	96, 208
BstXI	CCANNNNNNTGG	1 cut(s)	422
BstYI	RGATCY	2 cut(s)	96, 208
Bsu15I	ATCGAT	1 cut(s)	375
BsuI	GTATCC	1 cut(s)	62
BsuRI	GGCC	2 cut(s)	23, 414
BsuTUI	ATCGAT	1 cut(s)	375
BtsI	GCAGTG	1 cut(s)	492
BtsIMutI	CAGTG	4 cut(s)	255, 306, 442, 492
Cac8I	GCNNGC	2 cut(s)	166, 304
CciI	TCATGA	1 cut(s)	345
Cfr13I	GGNCC	2 cut(s)	128, 170
ClaI	ATCGAT	1 cut(s)	375
CpoI	CGGWCCG	1 cut(s)	170
Csp6I	GTAC	1 cut(s)	511
CspCI	CAANNNNNGTGG	2 cut(s)	574, 609
CspI	CGGWCCG	1 cut(s)	170
CviAII	CATG	7 cut(s)	56, 165, 179, 338, 346, 461, 516
CviJI	RGCY	9 cut(s)	23, 36, 221, 302, 405, 414, 547, 569, 575
CviKI_1	RGCY	9 cut(s)	23, 36, 221, 302, 405, 414, 547, 569, 575
CviQI	GTAC	1 cut(s)	511
DpnI	GATC	4 cut(s)	98, 210, 368, 378
DpnII	GATC	4 cut(s)	96, 208, 366, 376
EaeI	YGGCCR	1 cut(s)	412
Ecl136II	GAGCTC	1 cut(s)	569
Eco130I	CCWWGG	1 cut(s)	562
Eco24I	GRGCYC	1 cut(s)	571
Eco47I	GGWCC	2 cut(s)	128, 170
Eco53kI	GAGCTC	1 cut(s)	569
EcoICRI	GAGCTC	1 cut(s)	569
EcoNI	CCTNNNNNAGG	1 cut(s)	295
EcoRII	CCWGG	4 cut(s)	290, 317, 409, 414
EcoT14I	CCWWGG	1 cut(s)	562
EcoT38I	GRGCYC	1 cut(s)	571
ErhI	CCWWGG	1 cut(s)	562
FaeI	CATG	7 cut(s)	59, 168, 182, 341, 349, 464, 519
FaqI	GGGAC	2 cut(s)	114, 375
FatI	CATG	7 cut(s)	55, 164, 178, 337, 345, 460, 515
FauI	CCCGC	1 cut(s)	598
Fnu4HI	GCNGC	2 cut(s)	406, 617
FriOI	GRGCYC	1 cut(s)	571
Fsp4HI	GCNGC	2 cut(s)	406, 617
FspBI	CTAG	3 cut(s)	200, 303, 572
GluI	GCNGC	2 cut(s)	406, 617
GsuI	CTGGAG	1 cut(s)	444
HaeIII	GGCC	2 cut(s)	23, 414
HapII	CCGG	3 cut(s)	27, 132, 173
Hin1II	CATG	7 cut(s)	59, 168, 182, 341, 349, 464, 519
HinfI	GANTC	3 cut(s)	196, 282, 525
HpaII	CCGG	3 cut(s)	27, 132, 173
HphI	GGTGA	2 cut(s)	119, 253
Hpy188I	TCNGA	2 cut(s)	366, 530
Hpy188III	TCNNGA	4 cut(s)	346, 392, 423, 452
Hpy99I	CGWCG	1 cut(s)	50
HpyCH4III	ACNGT	3 cut(s)	50, 241, 250
HpyCH4IV	ACGT	1 cut(s)	354
HpyCH4V	TGCA	4 cut(s)	4, 164, 229, 485
HpyF10VI	GCNNNNNNNGC	1 cut(s)	411
HpySE526I	ACGT	1 cut(s)	354
Hsp92II	CATG	7 cut(s)	59, 168, 182, 341, 349, 464, 519
Kzo9I	GATC	4 cut(s)	96, 208, 366, 376
LmnI	GCTCC	1 cut(s)	566
Lsp1109I	GCAGC	2 cut(s)	392, 603
MaeI	CTAG	3 cut(s)	200, 303, 572
MaeII	ACGT	1 cut(s)	354
MaeIII	GTNAC	4 cut(s)	76, 235, 250, 442
MalI	GATC	4 cut(s)	98, 210, 368, 378
MboI	GATC	4 cut(s)	96, 208, 366, 376
MfeI	CAATTG	1 cut(s)	123
MflI	RGATCY	2 cut(s)	96, 208
MhlI	GDGCHC	1 cut(s)	571
MlsI	TGGCCA	1 cut(s)	414
MluCI	AATT	3 cut(s)	123, 183, 491
MluNI	TGGCCA	1 cut(s)	414
MlyI	GAGTC	1 cut(s)	205
MmeI	TCCRAC	1 cut(s)	358
MnlI	CCTC	2 cut(s)	34, 291
Mox20I	TGGCCA	1 cut(s)	414
MscI	TGGCCA	1 cut(s)	414
MseI	TTAA	3 cut(s)	12, 351, 429
Msp20I	TGGCCA	1 cut(s)	414
MspI	CCGG	3 cut(s)	27, 132, 173
MspR9I	CCNGG	6 cut(s)	132, 174, 292, 319, 411, 416
MunI	CAATTG	1 cut(s)	123
MvaI	CCWGG	4 cut(s)	292, 319, 411, 416
MwoI	GCNNNNNNNGC	1 cut(s)	411
NciI	CCSGG	2 cut(s)	132, 174
NdeII	GATC	4 cut(s)	96, 208, 366, 376
NheI	GCTAGC	1 cut(s)	302
NlaIII	CATG	7 cut(s)	59, 168, 182, 341, 349, 464, 519
NlaIV	GGNNCC	1 cut(s)	130
NmuCI	GTSAC	2 cut(s)	250, 442
NspI	RCATGY	2 cut(s)	168, 341
PaeI	GCATGC	1 cut(s)	168
PagI	TCATGA	1 cut(s)	345
PfeI	GAWTC	2 cut(s)	282, 525
PflFI	GACNNNGTC	1 cut(s)	174
PkrI	GCNGC	2 cut(s)	407, 618
Ple19I	CGATCG	1 cut(s)	369
PleI	GAGTC	1 cut(s)	204
PpsI	GAGTC	1 cut(s)	204
Psp124BI	GAGCTC	1 cut(s)	571
Psp1406I	AACGTT	1 cut(s)	354
Psp6I	CCWGG	4 cut(s)	290, 317, 409, 414
PspGI	CCWGG	4 cut(s)	290, 317, 409, 414
PspN4I	GGNNCC	1 cut(s)	130
PspPI	GGNCC	2 cut(s)	128, 170
PsuI	RGATCY	2 cut(s)	96, 208
PsyI	GACNNNGTC	1 cut(s)	174
PvuI	CGATCG	1 cut(s)	369
RsaI	GTAC	1 cut(s)	512
RsaNI	GTAC	1 cut(s)	511
Rsr2I	CGGWCCG	1 cut(s)	170
RsrII	CGGWCCG	1 cut(s)	170
SacI	GAGCTC	1 cut(s)	571
SaqAI	TTAA	3 cut(s)	12, 351, 429
SatI	GCNGC	2 cut(s)	406, 617
Sau3AI	GATC	4 cut(s)	96, 208, 366, 376
Sau96I	GGNCC	2 cut(s)	128, 170
SchI	GAGTC	1 cut(s)	205
ScrFI	CCNGG	6 cut(s)	132, 174, 292, 319, 411, 416
SduI	GDGCHC	1 cut(s)	571
SetI	ASST	6 cut(s)	223, 357, 420, 549, 571, 577
SfcI	CTRYAG	2 cut(s)	212, 632
SinI	GGWCC	2 cut(s)	128, 170
SphI	GCATGC	1 cut(s)	168
Sse9I	AATT	3 cut(s)	123, 183, 491
SsiI	CCGC	2 cut(s)	168, 605
SspI	AATATT	1 cut(s)	386
SspMI	CTAG	3 cut(s)	200, 303, 572
SstI	GAGCTC	1 cut(s)	571
StyD4I	CCNGG	6 cut(s)	130, 172, 290, 317, 409, 414
StyI	CCWWGG	1 cut(s)	562
TaaI	ACNGT	3 cut(s)	50, 241, 250
TaiI	ACGT	1 cut(s)	357
TaqI	TCGA	2 cut(s)	375, 495
TasI	AATT	3 cut(s)	123, 183, 491
TfiI	GAWTC	2 cut(s)	282, 525
Tru1I	TTAA	3 cut(s)	12, 351, 429
Tru9I	TTAA	3 cut(s)	12, 351, 429
TscAI	CASTG	4 cut(s)	255, 313, 442, 492
TseFI	GTSAC	2 cut(s)	250, 442
TseI	GCWGC	2 cut(s)	405, 616
Tsp45I	GTSAC	2 cut(s)	250, 442
TspDTI	ATGAA	1 cut(s)	449
TspRI	CASTG	4 cut(s)	255, 313, 442, 492
Tth111I	GACNNNGTC	1 cut(s)	174
VpaK11BI	GGWCC	2 cut(s)	128, 170
XagI	CCTNNNNNAGG	1 cut(s)	295
XapI	RAATTY	1 cut(s)	491
XceI	RCATGY	2 cut(s)	168, 341
XspI	CTAG	3 cut(s)	200, 303, 572

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.