Rmu_sc0008355.1_g000010

Polygalacturonase-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0008355.1
OG0000702
Physical Location & Seq
Forward (+)
24713 .. 25669
957 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0008355.1_g000010.1.cds

Sequence Viewer

Length: 744 bp
atgcagacattgagtttttccaactccaacaatattgtggttagcggattggtatctctaaacagccaaatgtttcacatagtggttaacggttgcaacaatgtgaaaatgcaaggggttaaagtatcggcctccggcaacagccctaacaccgacggtatccatgttcaaatgtcatcgggtgttaccattctcaactcaaagatctctactggtgatgactgcgtatcgattggtcccggcacttctaacttgtggattgaaaatgttgcatgcggaccgggtcatggaattagcattgggagtctaggcaaagatctacaggaagctggtgtgcaaaatgtaacggtgaaaacagtgacatttaccaatactcaaaatggtgtgagaatcaagtcctgggggagggctagcactggatttgccaggaacattcttttccaacatgctgtcatgattaacgttcaaaatccgatcgtcatcgatcaacaatattgtcccgacaaaaaaggctgccctggccaggtttctggagttaaaatcagtgatgtgacatatcaagacattcatggcacatcggcaacagaagttgcagtgaaattcgattgtagttcaaagtacccatgtagcagaatcagattggagaatgtgaagctcacatacaagaaccaaggagctctagcttcttgtagcaatgctggtggaacatctgcgggtatggtgctgcctacaagttgtctatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0005575 GO:0005576 GO:0005618 GO:0005623 GO:0030312 GO:0044464 GO:0071944
KEGG Pathways
Metabolic & Signaling
ko00040 ko01100 map00040 map01100
Pfam Domains
Protein Families
Glyco_hydro_28

Protein Analysis

247

Amino Acids

25.95

Weight (kDa)

8.73

Isoelectric Point (pI)

27.48

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000702)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G43870 AT3G59850 AT3G59850
fragaria_vesca FvH4_1g00290 FvH4_1g00290 FvH4_1g21842 FvH4_1g21850 FvH4_1g21851
malus_domestica MD00G1070500.v1.1 MD00G1087900.v1.1
prunus_persica Prupe.4G261700_v2.0.a1 Prupe.4G261800_v2.0.a1 Prupe.4G261900_v2.0.a1 Prupe.4G262200_v2.0.a1 Prupe.4G262200_v2.0.a1 Prupe.7G269200_v2.0.a1
pyrus_communis pycom02g00030 pycom03g19680
rosa_chinensis RchiOBHm_Chr2g0084591 RchiOBHm_Chr2g0085391 RchiOBHm_Chr2g0115741 RchiOBHm_Chr2g0115771 RchiOBHm_Chr2g0115801 RchiOBHm_Chr2g0115811 RchiOBHm_Chr2g0115821 RchiOBHm_Chr5g0021021 RchiOBHm_Chr5g0021031
rosa_laevigata RLG00000015683 RLG00000018208 RLG00000018211 RLG00000018212
rosa_multiflora Rmu_co8137638.1_g000001 Rmu_sc0000742.1_g000006 Rmu_sc0004926.1_g000013 Rmu_sc0008355.1_g000010 Rmu_sc0011452.1_g000015 Rmu_ssc0000197.1_g000031 Rmu_ssc0000197.1_g000032 Rmu_ssc0000197.1_g000056
rosa_roxburghii Rroxscaffold_2G00127770 Rroxscaffold_2G00127780 Rroxscaffold_2G00127790 Rroxscaffold_2G00127830 Rroxscaffold_2G00127850 Rroxscaffold_2G00128630 Rroxscaffold_2G00128640 Rroxscaffold_2G00128680 Rroxscaffold_2G00128730 Rroxscaffold_2G00128740
rosa_rugosa Rorug01G0455200 Rorug01G0460100 Rorug02G0199800 Rorug02G0199900
rosa_samantha Rh2BG003000 Rh2BG267500 Rh2BG267700 Rh2BG267800 Rh2BG267900 Rh2CG003400 Rh2CG010000 Rh2CG262800 Rh2CG263200 Rh2CG263300 Rh2CG263400 Rh5CG165700 Rh5CG165800
rosa_wichuraiana Rw0G014320 Rw0G014330 Rw1G010220 Rw2G000800 Rw2G020110 Rw2G020130 Rw2G020150 Rw2G020160

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 3 cut(s) 45, 276, 713
AclI AACGTT 1 cut(s) 462
AcoI YGGCCR 1 cut(s) 520
AcsI RAATTY 1 cut(s) 599
AdeI CACNNNGTG 1 cut(s) 82
AfaI GTAC 1 cut(s) 620
AfiI CCNNNNNNNGG 3 cut(s) 287, 405, 523
AgsI TTSAA 4 cut(s) 170, 263, 467, 615
AjnI CCWGG 4 cut(s) 398, 425, 517, 522
AluBI AGCT 4 cut(s) 329, 655, 677, 683
AluI AGCT 4 cut(s) 329, 655, 677, 683
Alw21I GWGCWC 1 cut(s) 679
AoxI GGCC 2 cut(s) 129, 520
ApeKI GCWGC 2 cut(s) 513, 724
ApoI RAATTY 1 cut(s) 599
AspS9I GGNCC 2 cut(s) 236, 278
AsuC2I CCSGG 2 cut(s) 240, 282
AsuHPI GGTGA 2 cut(s) 227, 361
AsuNHI GCTAGC 1 cut(s) 410
AvaII GGWCC 2 cut(s) 236, 278
BalI TGGCCA 1 cut(s) 522
BanII GRGCYC 1 cut(s) 679
BarI GAAGNNNNNNTAC 2 cut(s) 644, 676
Bbv12I GWGCWC 1 cut(s) 679
BbvI GCAGC 2 cut(s) 500, 711
BciT130I CCWGG 4 cut(s) 400, 427, 519, 524
BciVI GTATCC 1 cut(s) 170
BcnI CCSGG 2 cut(s) 240, 282
BfaI CTAG 3 cut(s) 308, 411, 680
BfmI CTRYAG 2 cut(s) 320, 740
BfuI GTATCC 1 cut(s) 170
BglII AGATCT 2 cut(s) 204, 316
BisI GCNGC 2 cut(s) 514, 725
BlsI GCNGC 2 cut(s) 515, 726
Bme1390I CCNGG 6 cut(s) 240, 282, 400, 427, 519, 524
Bme18I GGWCC 2 cut(s) 236, 278
BmgT120I GGNCC 2 cut(s) 236, 278
BmiI GGNNCC 1 cut(s) 238
BmrFI CCNGG 6 cut(s) 240, 282, 400, 427, 519, 524
BmtI GCTAGC 1 cut(s) 414
BpmI CTGGAG 1 cut(s) 552
BpuMI CCSGG 2 cut(s) 240, 282
Bsa29I ATCGAT 2 cut(s) 230, 483
BsaBI GATNNNNATC 2 cut(s) 52, 479
BsaJI CCNNGG 3 cut(s) 399, 517, 670
Bsc4I CCNNNNNNNGG 3 cut(s) 287, 405, 523
Bse1I ACTGG 2 cut(s) 217, 421
Bse3DI GCAATG 1 cut(s) 700
Bse8I GATNNNNATC 2 cut(s) 52, 479
BseBI CCWGG 4 cut(s) 400, 427, 519, 524
BseCI ATCGAT 2 cut(s) 230, 483
BseDI CCNNGG 3 cut(s) 399, 517, 670
BseJI GATNNNNATC 2 cut(s) 52, 479
BseLI CCNNNNNNNGG 3 cut(s) 287, 405, 523
BseMI GCAATG 1 cut(s) 700
BseNI ACTGG 2 cut(s) 217, 421
BseXI GCAGC 2 cut(s) 500, 711
Bsh1285I CGRYCG 1 cut(s) 477
BshFI GGCC 2 cut(s) 131, 522
BshVI ATCGAT 2 cut(s) 230, 483
BsiEI CGRYCG 1 cut(s) 477
BsiHKAI GWGCWC 1 cut(s) 679
BsiSI CCGG 3 cut(s) 135, 240, 281
BslFI GGGAC 2 cut(s) 222, 483
BslI CCNNNNNNNGG 3 cut(s) 287, 405, 523
BsmFI GGGAC 2 cut(s) 222, 483
BsnI GGCC 2 cut(s) 131, 522
Bsp1286I GDGCHC 1 cut(s) 679
Bsp143I GATC 4 cut(s) 204, 316, 474, 484
BspACI CCGC 3 cut(s) 45, 276, 713
BspANI GGCC 2 cut(s) 131, 522
BspDI ATCGAT 2 cut(s) 230, 483
BspHI TCATGA 1 cut(s) 453
BspLI GGNNCC 1 cut(s) 238
BspOI GCTAGC 1 cut(s) 414
BsrDI GCAATG 1 cut(s) 700
BsrI ACTGG 2 cut(s) 217, 421
BssECI CCNNGG 3 cut(s) 399, 517, 670
BssMI GATC 4 cut(s) 204, 316, 474, 484
BssT1I CCWWGG 1 cut(s) 670
Bst2UI CCWGG 4 cut(s) 400, 427, 519, 524
Bst4CI ACNGT 4 cut(s) 92, 158, 349, 358
BstC8I GCNNGC 2 cut(s) 274, 412
BstENI CCTNNNNNAGG 1 cut(s) 403
BstKTI GATC 4 cut(s) 207, 319, 477, 487
BstMBI GATC 4 cut(s) 204, 316, 474, 484
BstMCI CGRYCG 1 cut(s) 477
BstMWI GCNNNNNNNGC 1 cut(s) 519
BstNI CCWGG 4 cut(s) 400, 427, 519, 524
BstNSI RCATGY 2 cut(s) 276, 449
BstSCI CCNGG 6 cut(s) 238, 280, 398, 425, 517, 522
BstSFI CTRYAG 2 cut(s) 320, 740
BstV1I GCAGC 2 cut(s) 500, 711
BstX2I RGATCY 2 cut(s) 204, 316
BstXI CCANNNNNNTGG 1 cut(s) 530
BstYI RGATCY 2 cut(s) 204, 316
Bsu15I ATCGAT 2 cut(s) 230, 483
BsuI GTATCC 1 cut(s) 170
BsuRI GGCC 2 cut(s) 131, 522
BsuTUI ATCGAT 2 cut(s) 230, 483
BtsI GCAGTG 1 cut(s) 600
BtsIMutI CAGTG 4 cut(s) 363, 414, 550, 600
Cac8I GCNNGC 2 cut(s) 274, 412
CciI TCATGA 1 cut(s) 453
Cfr13I GGNCC 2 cut(s) 236, 278
ClaI ATCGAT 2 cut(s) 230, 483
CpoI CGGWCCG 1 cut(s) 278
Csp6I GTAC 1 cut(s) 619
CspCI CAANNNNNGTGG 2 cut(s) 682, 717
CspI CGGWCCG 1 cut(s) 278
CviAII CATG 7 cut(s) 164, 273, 287, 446, 454, 569, 624
CviQI GTAC 1 cut(s) 619
DpnI GATC 4 cut(s) 206, 318, 476, 486
DpnII GATC 4 cut(s) 204, 316, 474, 484
DraIII CACNNNGTG 1 cut(s) 82
EaeI YGGCCR 1 cut(s) 520
Ecl136II GAGCTC 1 cut(s) 677
Eco130I CCWWGG 1 cut(s) 670
Eco24I GRGCYC 1 cut(s) 679
Eco47I GGWCC 2 cut(s) 236, 278
Eco53kI GAGCTC 1 cut(s) 677
EcoICRI GAGCTC 1 cut(s) 677
EcoNI CCTNNNNNAGG 1 cut(s) 403
EcoRII CCWGG 4 cut(s) 398, 425, 517, 522
EcoT14I CCWWGG 1 cut(s) 670
EcoT38I GRGCYC 1 cut(s) 679
ErhI CCWWGG 1 cut(s) 670
FaeI CATG 7 cut(s) 167, 276, 290, 449, 457, 572, 627
FaqI GGGAC 2 cut(s) 222, 483
FatI CATG 7 cut(s) 163, 272, 286, 445, 453, 568, 623
FauI CCCGC 1 cut(s) 706
Fnu4HI GCNGC 2 cut(s) 514, 725
FriOI GRGCYC 1 cut(s) 679
Fsp4HI GCNGC 2 cut(s) 514, 725
FspBI CTAG 3 cut(s) 308, 411, 680
GluI GCNGC 2 cut(s) 514, 725
GsuI CTGGAG 1 cut(s) 552
HaeIII GGCC 2 cut(s) 131, 522
HapII CCGG 3 cut(s) 135, 240, 281
Hin1II CATG 7 cut(s) 167, 276, 290, 449, 457, 572, 627
HincII GTYRAC 1 cut(s) 88
HindII GTYRAC 1 cut(s) 88
HinfI GANTC 3 cut(s) 304, 390, 633
HpaI GTTAAC 1 cut(s) 88
HpaII CCGG 3 cut(s) 135, 240, 281
HphI GGTGA 2 cut(s) 227, 361
Hpy166II GTNNAC 1 cut(s) 88
Hpy188I TCNGA 2 cut(s) 474, 638
Hpy188III TCNNGA 4 cut(s) 454, 500, 531, 560
Hpy8I GTNNAC 1 cut(s) 88
Hpy99I CGWCG 1 cut(s) 158
HpyCH4III ACNGT 4 cut(s) 92, 158, 349, 358
HpyCH4IV ACGT 1 cut(s) 462
HpyCH4V TGCA 6 cut(s) 4, 96, 112, 272, 337, 593
HpyF10VI GCNNNNNNNGC 1 cut(s) 519
HpySE526I ACGT 1 cut(s) 462
Hsp92II CATG 7 cut(s) 167, 276, 290, 449, 457, 572, 627
KspAI GTTAAC 1 cut(s) 88
Kzo9I GATC 4 cut(s) 204, 316, 474, 484
LmnI GCTCC 1 cut(s) 674
Lsp1109I GCAGC 2 cut(s) 500, 711
MaeI CTAG 3 cut(s) 308, 411, 680
MaeII ACGT 1 cut(s) 462
MaeIII GTNAC 4 cut(s) 184, 343, 358, 550
MalI GATC 4 cut(s) 206, 318, 476, 486
MboI GATC 4 cut(s) 204, 316, 474, 484
MflI RGATCY 2 cut(s) 204, 316
MhlI GDGCHC 1 cut(s) 679
MlsI TGGCCA 1 cut(s) 522
MluCI AATT 2 cut(s) 291, 599
MluNI TGGCCA 1 cut(s) 522
MlyI GAGTC 1 cut(s) 313
MmeI TCCRAC 3 cut(s) 45, 51, 466
MnlI CCTC 2 cut(s) 142, 399
Mox20I TGGCCA 1 cut(s) 522
MscI TGGCCA 1 cut(s) 522
MseI TTAA 4 cut(s) 87, 120, 459, 537
Msp20I TGGCCA 1 cut(s) 522
MspI CCGG 3 cut(s) 135, 240, 281
MspR9I CCNGG 6 cut(s) 240, 282, 400, 427, 519, 524
MvaI CCWGG 4 cut(s) 400, 427, 519, 524
MwoI GCNNNNNNNGC 1 cut(s) 519
NciI CCSGG 2 cut(s) 240, 282
NdeII GATC 4 cut(s) 204, 316, 474, 484
NheI GCTAGC 1 cut(s) 410
NlaIII CATG 7 cut(s) 167, 276, 290, 449, 457, 572, 627
NlaIV GGNNCC 1 cut(s) 238
NmuCI GTSAC 2 cut(s) 358, 550
NspI RCATGY 2 cut(s) 276, 449
PaeI GCATGC 1 cut(s) 276
PagI TCATGA 1 cut(s) 453
PfeI GAWTC 2 cut(s) 390, 633
PflFI GACNNNGTC 1 cut(s) 282
PkrI GCNGC 2 cut(s) 515, 726
Ple19I CGATCG 1 cut(s) 477
PleI GAGTC 1 cut(s) 312
PpsI GAGTC 1 cut(s) 312
Psp124BI GAGCTC 1 cut(s) 679
Psp1406I AACGTT 1 cut(s) 462
Psp6I CCWGG 4 cut(s) 398, 425, 517, 522
PspGI CCWGG 4 cut(s) 398, 425, 517, 522
PspN4I GGNNCC 1 cut(s) 238
PspPI GGNCC 2 cut(s) 236, 278
PsuI RGATCY 2 cut(s) 204, 316
PsyI GACNNNGTC 1 cut(s) 282
PvuI CGATCG 1 cut(s) 477
RsaI GTAC 1 cut(s) 620
RsaNI GTAC 1 cut(s) 619
Rsr2I CGGWCCG 1 cut(s) 278
RsrII CGGWCCG 1 cut(s) 278
SacI GAGCTC 1 cut(s) 679
SaqAI TTAA 4 cut(s) 87, 120, 459, 537
SatI GCNGC 2 cut(s) 514, 725
Sau3AI GATC 4 cut(s) 204, 316, 474, 484
Sau96I GGNCC 2 cut(s) 236, 278
SchI GAGTC 1 cut(s) 313
ScrFI CCNGG 6 cut(s) 240, 282, 400, 427, 519, 524
SduI GDGCHC 1 cut(s) 679
SetI ASST 6 cut(s) 331, 465, 528, 657, 679, 685
SfcI CTRYAG 2 cut(s) 320, 740
SinI GGWCC 2 cut(s) 236, 278
SphI GCATGC 1 cut(s) 276
Sse9I AATT 2 cut(s) 291, 599
SsiI CCGC 3 cut(s) 45, 276, 713
SspI AATATT 2 cut(s) 34, 494
SspMI CTAG 3 cut(s) 308, 411, 680
SstI GAGCTC 1 cut(s) 679
StyD4I CCNGG 6 cut(s) 238, 280, 398, 425, 517, 522
StyI CCWWGG 1 cut(s) 670
TaaI ACNGT 4 cut(s) 92, 158, 349, 358
TaiI ACGT 1 cut(s) 465
TaqI TCGA 3 cut(s) 230, 483, 603
TasI AATT 2 cut(s) 291, 599
TfiI GAWTC 2 cut(s) 390, 633
Tru1I TTAA 4 cut(s) 87, 120, 459, 537
Tru9I TTAA 4 cut(s) 87, 120, 459, 537
TscAI CASTG 4 cut(s) 363, 421, 550, 600
TseFI GTSAC 2 cut(s) 358, 550
TseI GCWGC 2 cut(s) 513, 724
Tsp45I GTSAC 2 cut(s) 358, 550
TspDTI ATGAA 1 cut(s) 557
TspRI CASTG 4 cut(s) 363, 421, 550, 600
Tth111I GACNNNGTC 1 cut(s) 282
VpaK11BI GGWCC 2 cut(s) 236, 278
XagI CCTNNNNNAGG 1 cut(s) 403
XapI RAATTY 1 cut(s) 599
XceI RCATGY 2 cut(s) 276, 449
XcmI CCANNNNNNNNNTGG 1 cut(s) 34
XspI CTAG 3 cut(s) 308, 411, 680
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.