Rmu_sc0005581.1_g000009

Truncated transcription factor CAULIFLOWER

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005581.1
Physical Location & Seq
Reverse (-)
35958 .. 38938
2981 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0005581.1_g000009.1.cds

Sequence Viewer

Length: 402 bp
atgcctggatgtgctcactgccagaggcatgcatcaccagttcgatggagtttgattctattaagcatcatagacatttctgcccctggattgcatcaacaggtaatggagcacctggatggaaacaagcacactcagctttacaatgtcaagaagggatcacaacttctggaccttcatagagtgagttcatatatacagaagagtatttctgttttcagggaaactggactttggaacatgcaaagctcaaagctagggtgggggttttacagagaaatcaaagtcattttattgggggaggacctcctatccttaagtatgaaagagcttcagaatttggacctgcaacttgattttgctctaaagcacataaggtctagaaaggtgcaaaatcaatga

Protein Analysis

133

Amino Acids

15.3

Weight (kDa)

9.43

Isoelectric Point (pI)

47.78

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 354
AclWI GGATC 1 cut(s) 166
AcsI RAATTY 1 cut(s) 337
AcuI CTGAAG 1 cut(s) 317
AflII CTTAAG 1 cut(s) 316
AjnI CCWGG 3 cut(s) 4, 85, 114
AluBI AGCT 4 cut(s) 139, 249, 256, 331
AluI AGCT 4 cut(s) 139, 249, 256, 331
Alw21I GWGCWC 2 cut(s) 16, 114
AlwI GGATC 1 cut(s) 166
ApoI RAATTY 1 cut(s) 337
AspS9I GGNCC 3 cut(s) 172, 304, 343
AsuHPI GGTGA 1 cut(s) 27
AvaII GGWCC 3 cut(s) 172, 304, 343
Bbv12I GWGCWC 2 cut(s) 16, 114
BccI CCATC 2 cut(s) 39, 113
BciT130I CCWGG 3 cut(s) 6, 87, 116
BfaI CTAG 2 cut(s) 257, 381
BfrI CTTAAG 1 cut(s) 316
BfuAI ACCTGC 1 cut(s) 354
Bme1390I CCNGG 3 cut(s) 6, 87, 116
Bme18I GGWCC 3 cut(s) 172, 304, 343
BmgT120I GGNCC 3 cut(s) 172, 304, 343
BmrFI CCNGG 3 cut(s) 6, 87, 116
BmsI GCATC 3 cut(s) 41, 75, 103
BsaJI CCNNGG 1 cut(s) 85
Bse1I ACTGG 2 cut(s) 38, 232
BseBI CCWGG 3 cut(s) 6, 87, 116
BseDI CCNNGG 1 cut(s) 85
BseGI GGATG 2 cut(s) 14, 124
BseMII CTCAG 1 cut(s) 149
BseNI ACTGG 2 cut(s) 38, 232
BsiHKAI GWGCWC 2 cut(s) 16, 114
Bsp1286I GDGCHC 2 cut(s) 16, 114
Bsp143I GATC 1 cut(s) 158
BspCNI CTCAG 1 cut(s) 148
BspMI ACCTGC 1 cut(s) 354
BspPI GGATC 1 cut(s) 166
BspTI CTTAAG 1 cut(s) 316
BsrI ACTGG 2 cut(s) 38, 232
BssECI CCNNGG 1 cut(s) 85
BssMI GATC 1 cut(s) 158
Bst2UI CCWGG 3 cut(s) 6, 87, 116
Bst6I CTCTTC 1 cut(s) 197
BstAFI CTTAAG 1 cut(s) 316
BstC8I GCNNGC 1 cut(s) 30
BstDEI CTNAG 1 cut(s) 135
BstF5I GGATG 2 cut(s) 14, 124
BstKTI GATC 1 cut(s) 161
BstMBI GATC 1 cut(s) 158
BstMWI GCNNNNNNNGC 1 cut(s) 136
BstNI CCWGG 3 cut(s) 6, 87, 116
BstNSI RCATGY 2 cut(s) 32, 244
BstSCI CCNGG 3 cut(s) 4, 85, 114
BstXI CCANNNNNNTGG 1 cut(s) 45
BtsCI GGATG 2 cut(s) 14, 124
BtsI GCAGTG 1 cut(s) 16
BtsIMutI CAGTG 1 cut(s) 16
BveI ACCTGC 1 cut(s) 354
Cac8I GCNNGC 1 cut(s) 30
Cfr13I GGNCC 3 cut(s) 172, 304, 343
CviAII CATG 2 cut(s) 29, 241
CviJI RGCY 4 cut(s) 139, 249, 256, 331
CviKI_1 RGCY 4 cut(s) 139, 249, 256, 331
DdeI CTNAG 1 cut(s) 135
DpnI GATC 1 cut(s) 160
DpnII GATC 1 cut(s) 158
Eam1104I CTCTTC 1 cut(s) 197
EarI CTCTTC 1 cut(s) 197
Eco47I GGWCC 3 cut(s) 172, 304, 343
Eco57I CTGAAG 1 cut(s) 317
EcoO109I RGGNCCY 1 cut(s) 304
EcoRII CCWGG 3 cut(s) 4, 85, 114
EcoT22I ATGCAT 1 cut(s) 34
FaeI CATG 2 cut(s) 32, 244
FaiI YATR 9 cut(s) 30, 71, 180, 193, 195, 197, 242, 323, 374
FatI CATG 2 cut(s) 28, 240
FokI GGATG 2 cut(s) 21, 131
FspBI CTAG 2 cut(s) 257, 381
Hin1II CATG 2 cut(s) 32, 244
HinfI GANTC 1 cut(s) 55
HphI GGTGA 1 cut(s) 27
Hpy188I TCNGA 1 cut(s) 336
Hpy188III TCNNGA 3 cut(s) 151, 170, 381
HpyAV CCTTC 2 cut(s) 148, 185
HpyCH4V TGCA 5 cut(s) 32, 94, 244, 349, 391
HpyF10VI GCNNNNNNNGC 1 cut(s) 136
HpyF3I CTNAG 1 cut(s) 135
Hsp92II CATG 2 cut(s) 32, 244
Kzo9I GATC 1 cut(s) 158
LmnI GCTCC 1 cut(s) 109
LweI GCATC 3 cut(s) 41, 75, 103
MaeI CTAG 2 cut(s) 257, 381
MalI GATC 1 cut(s) 160
MboI GATC 1 cut(s) 158
MboII GAAGA 1 cut(s) 214
MhlI GDGCHC 2 cut(s) 16, 114
MluCI AATT 1 cut(s) 337
MnlI CCTC 3 cut(s) 18, 295, 317
Mph1103I ATGCAT 1 cut(s) 34
MseI TTAA 2 cut(s) 62, 317
MslI CAYNNNNRTG 1 cut(s) 117
MspCI CTTAAG 1 cut(s) 316
MspR9I CCNGG 3 cut(s) 6, 87, 116
MvaI CCWGG 3 cut(s) 6, 87, 116
MwoI GCNNNNNNNGC 1 cut(s) 136
NdeII GATC 1 cut(s) 158
NlaIII CATG 2 cut(s) 32, 244
NsiI ATGCAT 1 cut(s) 34
NspI RCATGY 2 cut(s) 32, 244
PaeI GCATGC 1 cut(s) 32
PfeI GAWTC 1 cut(s) 55
PpuMI RGGWCCY 1 cut(s) 304
Psp5II RGGWCCY 1 cut(s) 304
Psp6I CCWGG 3 cut(s) 4, 85, 114
PspGI CCWGG 3 cut(s) 4, 85, 114
PspPI GGNCC 3 cut(s) 172, 304, 343
PspPPI RGGWCCY 1 cut(s) 304
RseI CAYNNNNRTG 1 cut(s) 117
SaqAI TTAA 2 cut(s) 62, 317
Sau3AI GATC 1 cut(s) 158
Sau96I GGNCC 3 cut(s) 172, 304, 343
ScrFI CCNGG 3 cut(s) 6, 87, 116
SduI GDGCHC 2 cut(s) 16, 114
SfaNI GCATC 3 cut(s) 41, 75, 103
SinI GGWCC 3 cut(s) 172, 304, 343
SmiMI CAYNNNNRTG 1 cut(s) 117
SmlI CTYRAG 1 cut(s) 316
SmoI CTYRAG 1 cut(s) 316
SphI GCATGC 1 cut(s) 32
Sse9I AATT 1 cut(s) 337
SspMI CTAG 2 cut(s) 257, 381
StyD4I CCNGG 3 cut(s) 4, 85, 114
TaqI TCGA 1 cut(s) 43
TasI AATT 1 cut(s) 337
TfiI GAWTC 1 cut(s) 55
Tru1I TTAA 2 cut(s) 62, 317
Tru9I TTAA 2 cut(s) 62, 317
TscAI CASTG 1 cut(s) 23
TspDTI ATGAA 3 cut(s) 167, 180, 338
TspRI CASTG 1 cut(s) 23
Vha464I CTTAAG 1 cut(s) 316
VpaK11BI GGWCC 3 cut(s) 172, 304, 343
XapI RAATTY 1 cut(s) 337
XbaI TCTAGA 1 cut(s) 380
XceI RCATGY 2 cut(s) 32, 244
XspI CTAG 2 cut(s) 257, 381
Zsp2I ATGCAT 1 cut(s) 34
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.