Rh5CG061900

Truncated transcription factor CAULIFLOWER

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5C
Physical Location & Seq
Forward (+)
4644942 .. 4651890
6949 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5CG061900.1

Sequence Viewer

Length: 225 bp
ATGGGGACTGGCTATGATAATGCCACTTCTGAAGTTGCTACTCTGGAACATGCAAAGCTCAGAGCTAGGGTGGAGATTTTACAGAGAAATCAAAGTCATTTTATGGGGGAAGACCTCCAATCCTTGAGTATGAAAGAGCTTCAGAATTTGGAGCAGCTACTTGATTCTGCTCTGAAGCACATAAGGAGAGAGAGAAATCAAGTAACCATACCAAAAATTCCTTGA

Protein Analysis

74

Amino Acids

8.5

Weight (kDa)

6.83

Isoelectric Point (pI)

58.08

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
K-box PF01486 10 - 73 5.9e-19 K-box region
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 145, 216
AcuI CTGAAG 3 cut(s) 51, 125, 194
AluBI AGCT 4 cut(s) 58, 65, 139, 157
AluI AGCT 4 cut(s) 58, 65, 139, 157
ApeKI GCWGC 1 cut(s) 154
ApoI RAATTY 2 cut(s) 145, 216
BbsI GAAGAC 1 cut(s) 117
BbvI GCAGC 1 cut(s) 166
BfaI CTAG 1 cut(s) 66
BisI GCNGC 1 cut(s) 155
BlsI GCNGC 1 cut(s) 156
BpiI GAAGAC 1 cut(s) 117
BpuEI CTTGAG 1 cut(s) 145
Bse1I ACTGG 1 cut(s) 13
BseMII CTCAG 1 cut(s) 73
BseNI ACTGG 1 cut(s) 13
BseXI GCAGC 1 cut(s) 166
BslFI GGGAC 1 cut(s) 19
BsmFI GGGAC 1 cut(s) 19
BspCNI CTCAG 1 cut(s) 72
BsrI ACTGG 1 cut(s) 13
BstDEI CTNAG 1 cut(s) 59
BstNSI RCATGY 1 cut(s) 53
BstV1I GCAGC 1 cut(s) 166
BstV2I GAAGAC 1 cut(s) 117
CviAII CATG 1 cut(s) 50
CviJI RGCY 5 cut(s) 12, 58, 65, 139, 157
CviKI_1 RGCY 5 cut(s) 12, 58, 65, 139, 157
DdeI CTNAG 1 cut(s) 59
Eco57I CTGAAG 3 cut(s) 51, 125, 194
FaeI CATG 1 cut(s) 53
FaiI YATR 6 cut(s) 15, 51, 104, 131, 182, 209
FaqI GGGAC 1 cut(s) 19
FatI CATG 1 cut(s) 49
Fnu4HI GCNGC 1 cut(s) 155
Fsp4HI GCNGC 1 cut(s) 155
FspBI CTAG 1 cut(s) 66
GluI GCNGC 1 cut(s) 155
Hin1II CATG 1 cut(s) 53
HinfI GANTC 1 cut(s) 164
Hpy188I TCNGA 4 cut(s) 31, 62, 144, 174
Hpy188III TCNNGA 1 cut(s) 44
HpyCH4V TGCA 1 cut(s) 53
HpyF3I CTNAG 1 cut(s) 59
Hsp92II CATG 1 cut(s) 53
LmnI GCTCC 1 cut(s) 151
LpnPI CCDG 1 cut(s) 29
Lsp1109I GCAGC 1 cut(s) 166
MaeI CTAG 1 cut(s) 66
MaeIII GTNAC 1 cut(s) 202
MboII GAAGA 1 cut(s) 122
MluCI AATT 2 cut(s) 145, 216
MnlI CCTC 1 cut(s) 125
NlaIII CATG 1 cut(s) 53
NspI RCATGY 1 cut(s) 53
PfeI GAWTC 1 cut(s) 164
PkrI GCNGC 1 cut(s) 156
SatI GCNGC 1 cut(s) 155
SetI ASST 5 cut(s) 60, 67, 117, 141, 159
SgeI CNNG 7 cut(s) 21, 56, 62, 78, 136, 173, 212
SmlI CTYRAG 1 cut(s) 124
SmoI CTYRAG 1 cut(s) 124
Sse9I AATT 2 cut(s) 145, 216
SspMI CTAG 1 cut(s) 66
TasI AATT 2 cut(s) 145, 216
TfiI GAWTC 1 cut(s) 164
TseI GCWGC 1 cut(s) 154
TspDTI ATGAA 1 cut(s) 146
XapI RAATTY 2 cut(s) 145, 216
XceI RCATGY 1 cut(s) 53
XspI CTAG 1 cut(s) 66
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.