Rh5DG010300

Truncated transcription factor CAULIFLOWER

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5D
Physical Location & Seq
Forward (+)
730709 .. 733340
2632 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5DG010300.1

Sequence Viewer

Length: 240 bp
ATGTTGCATAGGGAATCCCGACTCTGGAACATGCAAAGCTCAAAGCTAGGGTGGAGTCATTTTATGGGGAAAGGCCTCCAATCCTTAAGTATGAAAGATCTTCAGAATTTGGAGCAGCAACTTGATTTTGCTCTGAAGCACATGAGGTCTAGAAAGGTAATGCTGCTAGAGCATCACCACACCTCAATTTCAAGCCCCACAAATGAGAAAAATGTAGCAGACTATGAAGAAATCAACTGA

Protein Analysis

79

Amino Acids

9.34

Weight (kDa)

8.17

Isoelectric Point (pI)

54.74

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
K-box PF01486 19 - 59 1.6e-11 K-box region
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 106
AcuI CTGAAG 2 cut(s) 86, 155
AfiI CCNNNNNNNGG 1 cut(s) 24
AflII CTTAAG 1 cut(s) 85
AgsI TTSAA 1 cut(s) 192
AluBI AGCT 2 cut(s) 39, 46
AluI AGCT 2 cut(s) 39, 46
AoxI GGCC 1 cut(s) 73
ApeKI GCWGC 2 cut(s) 115, 163
ApoI RAATTY 1 cut(s) 106
AsuHPI GGTGA 1 cut(s) 167
BbvI GCAGC 2 cut(s) 127, 150
BfaI CTAG 3 cut(s) 47, 150, 167
BfrI CTTAAG 1 cut(s) 85
BglII AGATCT 1 cut(s) 97
BisI GCNGC 2 cut(s) 116, 164
BlsI GCNGC 2 cut(s) 117, 165
BmsI GCATC 1 cut(s) 181
Bsc4I CCNNNNNNNGG 1 cut(s) 24
BseLI CCNNNNNNNGG 1 cut(s) 24
BseXI GCAGC 2 cut(s) 127, 150
BshFI GGCC 1 cut(s) 75
BslI CCNNNNNNNGG 1 cut(s) 24
BsnI GGCC 1 cut(s) 75
Bsp143I GATC 1 cut(s) 97
BspANI GGCC 1 cut(s) 75
BspTI CTTAAG 1 cut(s) 85
BssMI GATC 1 cut(s) 97
BstAFI CTTAAG 1 cut(s) 85
BstKTI GATC 1 cut(s) 100
BstMBI GATC 1 cut(s) 97
BstMWI GCNNNNNNNGC 1 cut(s) 169
BstNSI RCATGY 1 cut(s) 34
BstV1I GCAGC 2 cut(s) 127, 150
BstX2I RGATCY 1 cut(s) 97
BstYI RGATCY 1 cut(s) 97
BsuRI GGCC 1 cut(s) 75
CviAII CATG 2 cut(s) 31, 142
CviJI RGCY 4 cut(s) 39, 46, 75, 195
CviKI_1 RGCY 4 cut(s) 39, 46, 75, 195
DpnI GATC 1 cut(s) 99
DpnII GATC 1 cut(s) 97
Eco147I AGGCCT 1 cut(s) 75
Eco57I CTGAAG 2 cut(s) 86, 155
FaeI CATG 2 cut(s) 34, 145
FaiI YATR 6 cut(s) 9, 32, 65, 92, 143, 225
FatI CATG 2 cut(s) 30, 141
Fnu4HI GCNGC 2 cut(s) 116, 164
Fsp4HI GCNGC 2 cut(s) 116, 164
FspBI CTAG 3 cut(s) 47, 150, 167
GluI GCNGC 2 cut(s) 116, 164
HaeIII GGCC 1 cut(s) 75
Hin1II CATG 2 cut(s) 34, 145
HinfI GANTC 3 cut(s) 14, 21, 55
HphI GGTGA 1 cut(s) 167
Hpy188I TCNGA 2 cut(s) 105, 135
Hpy188III TCNNGA 3 cut(s) 18, 25, 150
HpyCH4V TGCA 2 cut(s) 7, 34
HpyF10VI GCNNNNNNNGC 1 cut(s) 169
Hsp92II CATG 2 cut(s) 34, 145
Kzo9I GATC 1 cut(s) 97
LmnI GCTCC 1 cut(s) 112
LpnPI CCDG 1 cut(s) 10
Lsp1109I GCAGC 2 cut(s) 127, 150
LweI GCATC 1 cut(s) 181
MaeI CTAG 3 cut(s) 47, 150, 167
MalI GATC 1 cut(s) 99
MboI GATC 1 cut(s) 97
MboII GAAGA 2 cut(s) 92, 239
MflI RGATCY 1 cut(s) 97
MluCI AATT 2 cut(s) 106, 186
MlyI GAGTC 2 cut(s) 15, 64
MnlI CCTC 3 cut(s) 86, 138, 193
MseI TTAA 1 cut(s) 86
MspCI CTTAAG 1 cut(s) 85
MwoI GCNNNNNNNGC 1 cut(s) 169
NdeII GATC 1 cut(s) 97
NlaIII CATG 2 cut(s) 34, 145
NspI RCATGY 1 cut(s) 34
PceI AGGCCT 1 cut(s) 75
PfeI GAWTC 1 cut(s) 14
PkrI GCNGC 2 cut(s) 117, 165
PleI GAGTC 2 cut(s) 15, 63
PpsI GAGTC 2 cut(s) 15, 63
PsuI RGATCY 1 cut(s) 97
SaqAI TTAA 1 cut(s) 86
SatI GCNGC 2 cut(s) 116, 164
Sau3AI GATC 1 cut(s) 97
SchI GAGTC 2 cut(s) 15, 64
SetI ASST 5 cut(s) 41, 48, 149, 159, 185
SfaNI GCATC 1 cut(s) 181
SgeI CNNG 9 cut(s) 30, 37, 43, 59, 134, 154, 162, 179, 204
SmlI CTYRAG 1 cut(s) 85
SmoI CTYRAG 1 cut(s) 85
Sse9I AATT 2 cut(s) 106, 186
SseBI AGGCCT 1 cut(s) 75
SspMI CTAG 3 cut(s) 47, 150, 167
StuI AGGCCT 1 cut(s) 75
TasI AATT 2 cut(s) 106, 186
TfiI GAWTC 1 cut(s) 14
Tru1I TTAA 1 cut(s) 86
Tru9I TTAA 1 cut(s) 86
TseI GCWGC 2 cut(s) 115, 163
TspDTI ATGAA 2 cut(s) 107, 240
Vha464I CTTAAG 1 cut(s) 85
XapI RAATTY 1 cut(s) 106
XbaI TCTAGA 1 cut(s) 149
XceI RCATGY 1 cut(s) 34
XspI CTAG 3 cut(s) 47, 150, 167
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.