Rmu_sc0005838.1_g000012

serine threonine-protein phosphatase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005838.1
OG0002717
Physical Location & Seq
Forward (+)
35414 .. 40763
5350 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 792 bp
atggttgttgttcaaggccttggaccagggccacgctacgggcatgtgatggcattggtggggcaaagatatctcatggcaattggtgggaatgatggtaaacggcctttagctgatgtttgggcgctggacacagctgccaagccatatgaatggcataagttggaaccagagggggaagtccaccaccatgcatgtatgcaagtgcaagtccaaggtcggatggtcttctcctcctttgtagagggagggatgcaaacagtgtgggatggccgttgggaatgggcaattgctcctggcgtctccccttctcccagatatcaacatgcagcagtttttgttaatgcacgcttgcatgtttccggaggggcccttggtggtgggcgcatggttgaagattcatcaagtgttggagtgttggatactgcagccggggtttggtgcgatacaaaatctgttgtcatgagtccaaggacaggtagatacagcgctgatgcagctggtggagatgctgcagttgaattgacacggcgttgcaggcatgcagctgctgcggttggactagctggtgccacagctgatgtgcactgttatgacatcctaacaaataaatggtctaggatcactccctttggagaaccaccaacaccaagggcagcacatgtagcaactgctgtaggaactatggttgttattcagggaggaattggtcctgctggtttgtctgctgaagatttacatgttcttgacctcactcagcaacggcctcgatggcacaggttaaacttttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005886 GO:0016020 GO:0044424 GO:0044464 GO:0071944
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Kelch_2 Kelch_4 Metallophos

Protein Analysis

263

Amino Acids

28.09

Weight (kDa)

7.21

Isoelectric Point (pI)

35.57

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Beta-prop_FBX42 PF13415 3 - 71 5.2e-06 FBX42, beta-propeller domain
Kelch_KLHDC2_KLHL20_DRC7 PF24681 4 - 67 1.9e-08 KLHDC2/KLHL20/DRC7 Kelch-repeats domain
Kelch_KLHDC2_KLHL20_DRC7 PF24681 93 - 235 9.2e-17 KLHDC2/KLHL20/DRC7 Kelch-repeats domain
Kelch_2 PF07646 105 - 152 5.5e-08 Kelch motif
Kelch_KLHDC2_KLHL20_DRC7 PF24681 192 - 261 5.5e-12 KLHDC2/KLHL20/DRC7 Kelch-repeats domain
Beta-prop_FBX42 PF13415 192 - 254 6.3e-10 FBX42, beta-propeller domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 569
AccIII TCCGGA 1 cut(s) 362
AciI CCGC 1 cut(s) 554
AclWI GGATC 1 cut(s) 629
AcoI YGGCCR 1 cut(s) 271
AcuI CTGAAG 1 cut(s) 750
AcyI GRCGYC 1 cut(s) 300
AfeI AGCGCT 1 cut(s) 490
AfiI CCNNNNNNNGG 3 cut(s) 38, 438, 476
AflIII ACRYGT 2 cut(s) 661, 739
AgsI TTSAA 3 cut(s) 14, 395, 521
AjnI CCWGG 2 cut(s) 25, 295
AluBI AGCT 6 cut(s) 113, 137, 500, 548, 566, 578
AluI AGCT 6 cut(s) 113, 137, 500, 548, 566, 578
Alw21I GWGCWC 1 cut(s) 588
Alw26I GTCTC 1 cut(s) 307
Alw44I GTGCAC 1 cut(s) 584
AlwI GGATC 1 cut(s) 629
AlwNI CAGNNNCTG 1 cut(s) 551
Aor13HI TCCGGA 1 cut(s) 362
Aor51HI AGCGCT 1 cut(s) 490
AoxI GGCC 6 cut(s) 16, 29, 104, 271, 369, 764
ApaI GGGCCC 1 cut(s) 373
ApaLI GTGCAC 1 cut(s) 584
ApeKI GCWGC 9 cut(s) 137, 329, 428, 497, 512, 545, 548, 551, 656
ArsI GACNNNNNNTTYG 2 cut(s) 599, 631
AspLEI GCGC 3 cut(s) 127, 387, 491
AspS9I GGNCC 5 cut(s) 23, 29, 369, 370, 710
AsuC2I CCSGG 1 cut(s) 433
AvaII GGWCC 2 cut(s) 23, 710
BaeGI GKGCMC 2 cut(s) 373, 588
BanI GGYRCC 1 cut(s) 569
BanII GRGCYC 1 cut(s) 373
BbsI GAAGAC 1 cut(s) 220
Bbv12I GWGCWC 1 cut(s) 588
BbvI GCAGC 9 cut(s) 124, 341, 440, 499, 509, 535, 538, 557, 668
BccI CCATC 5 cut(s) 43, 89, 217, 263, 765
BceAI ACGGC 4 cut(s) 119, 258, 545, 779
BcgI CGANNNNNNTGC 2 cut(s) 749, 783
BciT130I CCWGG 2 cut(s) 27, 297
BciVI GTATCC 1 cut(s) 415
BcnI CCSGG 1 cut(s) 433
BcoDI GTCTC 1 cut(s) 307
BfaI CTAG 2 cut(s) 563, 618
BfmI CTRYAG 3 cut(s) 426, 513, 675
BfoI RGCGCY 2 cut(s) 128, 492
BfuI GTATCC 1 cut(s) 415
BglI GCCNNNNNGGC 1 cut(s) 772
BisI GCNGC 9 cut(s) 138, 330, 429, 498, 513, 546, 549, 552, 657
BlsI GCNGC 9 cut(s) 139, 331, 430, 499, 514, 547, 550, 553, 658
Bme1390I CCNGG 3 cut(s) 27, 297, 433
Bme18I GGWCC 2 cut(s) 23, 710
BmgT120I GGNCC 5 cut(s) 23, 29, 369, 370, 710
BmiI GGNNCC 4 cut(s) 168, 370, 371, 571
BmrFI CCNGG 3 cut(s) 27, 297, 433
BmsI GCATC 3 cut(s) 243, 484, 499
BpiI GAAGAC 1 cut(s) 220
BpuMI CCSGG 1 cut(s) 433
BsaHI GRCGYC 1 cut(s) 300
BsaJI CCNNGG 7 cut(s) 19, 26, 214, 373, 432, 470, 650
BsaWI WCCGGW 1 cut(s) 362
Bsc4I CCNNNNNNNGG 3 cut(s) 38, 438, 476
BseAI TCCGGA 1 cut(s) 362
BseBI CCWGG 2 cut(s) 27, 297
BseDI CCNNGG 7 cut(s) 19, 26, 214, 373, 432, 470, 650
BseGI GGATG 4 cut(s) 228, 258, 274, 597
BseLI CCNNNNNNNGG 3 cut(s) 38, 438, 476
BseMII CTCAG 1 cut(s) 770
BseRI GAGGAG 1 cut(s) 223
BseSI GKGCMC 2 cut(s) 373, 588
BseXI GCAGC 9 cut(s) 124, 341, 440, 499, 509, 535, 538, 557, 668
BshFI GGCC 6 cut(s) 18, 31, 106, 273, 371, 766
BshNI GGYRCC 1 cut(s) 569
BsiHKAI GWGCWC 1 cut(s) 588
BsiSI CCGG 2 cut(s) 363, 432
BslI CCNNNNNNNGG 3 cut(s) 38, 438, 476
BsmAI GTCTC 1 cut(s) 307
BsmBI CGTCTC 1 cut(s) 307
BsnI GGCC 6 cut(s) 18, 31, 106, 273, 371, 766
Bsp120I GGGCCC 1 cut(s) 369
Bsp1286I GDGCHC 2 cut(s) 373, 588
Bsp13I TCCGGA 1 cut(s) 362
Bsp143I GATC 1 cut(s) 621
BspACI CCGC 1 cut(s) 554
BspANI GGCC 6 cut(s) 18, 31, 106, 273, 371, 766
BspCNI CTCAG 1 cut(s) 769
BspEI TCCGGA 1 cut(s) 362
BspHI TCATGA 1 cut(s) 462
BspLI GGNNCC 4 cut(s) 168, 370, 371, 571
BspMAI CTGCAG 2 cut(s) 430, 517
BspPI GGATC 1 cut(s) 629
BspT107I GGYRCC 1 cut(s) 569
BssECI CCNNGG 7 cut(s) 19, 26, 214, 373, 432, 470, 650
BssMI GATC 1 cut(s) 621
BssNI GRCGYC 1 cut(s) 300
BssT1I CCWWGG 5 cut(s) 19, 214, 373, 470, 650
Bst2UI CCWGG 2 cut(s) 27, 297
Bst4CI ACNGT 2 cut(s) 262, 590
BstACI GRCGYC 1 cut(s) 300
BstAPI GCANNNNNTGC 1 cut(s) 551
BstC8I GCNNGC 4 cut(s) 349, 353, 539, 543
BstDEI CTNAG 1 cut(s) 756
BstF5I GGATG 4 cut(s) 228, 258, 274, 597
BstH2I RGCGCY 2 cut(s) 128, 492
BstHHI GCGC 3 cut(s) 127, 387, 491
BstKTI GATC 1 cut(s) 624
BstMAI GTCTC 1 cut(s) 307
BstMBI GATC 1 cut(s) 621
BstMWI GCNNNNNNNGC 5 cut(s) 497, 538, 551, 665, 772
BstNI CCWGG 2 cut(s) 27, 297
BstNSI RCATGY 7 cut(s) 47, 198, 329, 359, 545, 665, 743
BstSCI CCNGG 3 cut(s) 25, 295, 431
BstSFI CTRYAG 3 cut(s) 426, 513, 675
BstSLI GKGCMC 2 cut(s) 373, 588
BstV1I GCAGC 9 cut(s) 124, 341, 440, 499, 509, 535, 538, 557, 668
BstV2I GAAGAC 1 cut(s) 220
BstXI CCANNNNNNTGG 1 cut(s) 153
BsuI GTATCC 1 cut(s) 415
BsuRI GGCC 6 cut(s) 18, 31, 106, 273, 371, 766
BtsCI GGATG 4 cut(s) 228, 258, 274, 597
BtsIMutI CAGTG 2 cut(s) 267, 586
Cac8I GCNNGC 4 cut(s) 349, 353, 539, 543
CaiI CAGNNNCTG 1 cut(s) 551
CciI TCATGA 1 cut(s) 462
CfoI GCGC 3 cut(s) 127, 387, 491
Cfr13I GGNCC 5 cut(s) 23, 29, 369, 370, 710
CseI GACGC 1 cut(s) 289
CspCI CAANNNNNGTGG 2 cut(s) 245, 280
DdeI CTNAG 1 cut(s) 756
DpnI GATC 1 cut(s) 623
DpnII GATC 1 cut(s) 621
EaeI YGGCCR 1 cut(s) 271
Eco130I CCWWGG 5 cut(s) 19, 214, 373, 470, 650
Eco147I AGGCCT 1 cut(s) 18
Eco24I GRGCYC 1 cut(s) 373
Eco32I GATATC 2 cut(s) 71, 320
Eco47I GGWCC 2 cut(s) 23, 710
Eco47III AGCGCT 1 cut(s) 490
Eco57I CTGAAG 1 cut(s) 750
EcoO109I RGGNCCY 2 cut(s) 369, 370
EcoRII CCWGG 2 cut(s) 25, 295
EcoRV GATATC 2 cut(s) 71, 320
EcoT14I CCWWGG 5 cut(s) 19, 214, 373, 470, 650
EcoT22I ATGCAT 1 cut(s) 196
EcoT38I GRGCYC 1 cut(s) 373
ErhI CCWWGG 5 cut(s) 19, 214, 373, 470, 650
Esp3I CGTCTC 1 cut(s) 307
FauNDI CATATG 1 cut(s) 148
Fnu4HI GCNGC 9 cut(s) 138, 330, 429, 498, 513, 546, 549, 552, 657
FokI GGATG 4 cut(s) 235, 265, 281, 584
FriOI GRGCYC 1 cut(s) 373
Fsp4HI GCNGC 9 cut(s) 138, 330, 429, 498, 513, 546, 549, 552, 657
FspBI CTAG 2 cut(s) 563, 618
GlaI GCGC 3 cut(s) 126, 386, 490
GluI GCNGC 9 cut(s) 138, 330, 429, 498, 513, 546, 549, 552, 657
HaeII RGCGCY 2 cut(s) 128, 492
HaeIII GGCC 6 cut(s) 18, 31, 106, 273, 371, 766
HapII CCGG 2 cut(s) 363, 432
HgaI GACGC 1 cut(s) 289
HhaI GCGC 3 cut(s) 127, 387, 491
Hin1I GRCGYC 1 cut(s) 300
Hin6I GCGC 3 cut(s) 125, 385, 489
HinP1I GCGC 3 cut(s) 125, 385, 489
HinfI GANTC 2 cut(s) 398, 466
HpaII CCGG 2 cut(s) 363, 432
Hpy166II GTNNAC 3 cut(s) 101, 184, 586
Hpy188I TCNGA 1 cut(s) 222
Hpy188III TCNNGA 3 cut(s) 363, 463, 746
Hpy8I GTNNAC 3 cut(s) 101, 184, 586
HpyAV CCTTC 1 cut(s) 318
HpyCH4III ACNGT 2 cut(s) 262, 590
HpyF10VI GCNNNNNNNGC 5 cut(s) 497, 538, 551, 665, 772
HpyF3I CTNAG 1 cut(s) 756
Hsp92I GRCGYC 1 cut(s) 300
HspAI GCGC 3 cut(s) 125, 385, 489
Kpn2I TCCGGA 1 cut(s) 362
Kzo9I GATC 1 cut(s) 621
LmnI GCTCC 1 cut(s) 298
Lsp1109I GCAGC 9 cut(s) 124, 341, 440, 499, 509, 535, 538, 557, 668
LweI GCATC 3 cut(s) 243, 484, 499
MaeI CTAG 2 cut(s) 563, 618
MalI GATC 1 cut(s) 623
MboI GATC 1 cut(s) 621
MboII GAAGA 3 cut(s) 220, 407, 743
MfeI CAATTG 2 cut(s) 81, 288
MhlI GDGCHC 2 cut(s) 373, 588
MluCI AATT 4 cut(s) 81, 288, 521, 705
MlyI GAGTC 1 cut(s) 475
MmeI TCCRAC 5 cut(s) 144, 200, 391, 399, 538
MnlI CCTC 8 cut(s) 166, 238, 242, 244, 359, 695, 761, 777
Mph1103I ATGCAT 1 cut(s) 196
MroI TCCGGA 1 cut(s) 362
MseI TTAA 2 cut(s) 342, 782
MslI CAYNNNNRTG 3 cut(s) 151, 189, 591
MspA1I CMGCKG 4 cut(s) 137, 500, 548, 578
MspI CCGG 2 cut(s) 363, 432
MspR9I CCNGG 3 cut(s) 27, 297, 433
MunI CAATTG 2 cut(s) 81, 288
MvaI CCWGG 2 cut(s) 27, 297
MwoI GCNNNNNNNGC 5 cut(s) 497, 538, 551, 665, 772
NciI CCSGG 1 cut(s) 433
NdeI CATATG 1 cut(s) 148
NdeII GATC 1 cut(s) 621
NlaIV GGNNCC 4 cut(s) 168, 370, 371, 571
NsiI ATGCAT 1 cut(s) 196
NspI RCATGY 7 cut(s) 47, 198, 329, 359, 545, 665, 743
PaeI GCATGC 1 cut(s) 545
PagI TCATGA 1 cut(s) 462
PceI AGGCCT 1 cut(s) 18
PciI ACATGT 2 cut(s) 661, 739
PfeI GAWTC 1 cut(s) 398
PkrI GCNGC 9 cut(s) 139, 331, 430, 499, 514, 547, 550, 553, 658
PleI GAGTC 1 cut(s) 474
PpsI GAGTC 1 cut(s) 474
PscI ACATGT 2 cut(s) 661, 739
Psp6I CCWGG 2 cut(s) 25, 295
PspGI CCWGG 2 cut(s) 25, 295
PspN4I GGNNCC 4 cut(s) 168, 370, 371, 571
PspOMI GGGCCC 1 cut(s) 369
PspPI GGNCC 5 cut(s) 23, 29, 369, 370, 710
PstI CTGCAG 2 cut(s) 430, 517
PstNI CAGNNNCTG 1 cut(s) 551
PvuII CAGCTG 4 cut(s) 137, 500, 548, 578
RseI CAYNNNNRTG 3 cut(s) 151, 189, 591
SaqAI TTAA 2 cut(s) 342, 782
SatI GCNGC 9 cut(s) 138, 330, 429, 498, 513, 546, 549, 552, 657
Sau3AI GATC 1 cut(s) 621
Sau96I GGNCC 5 cut(s) 23, 29, 369, 370, 710
SchI GAGTC 1 cut(s) 475
ScrFI CCNGG 3 cut(s) 27, 297, 433
SduI GDGCHC 2 cut(s) 373, 588
SfaNI GCATC 3 cut(s) 243, 484, 499
SfcI CTRYAG 3 cut(s) 426, 513, 675
SinI GGWCC 2 cut(s) 23, 710
SmiMI CAYNNNNRTG 3 cut(s) 151, 189, 591
SphI GCATGC 1 cut(s) 545
Sse9I AATT 4 cut(s) 81, 288, 521, 705
SseBI AGGCCT 1 cut(s) 18
SsiI CCGC 1 cut(s) 554
SspMI CTAG 2 cut(s) 563, 618
StuI AGGCCT 1 cut(s) 18
StyD4I CCNGG 3 cut(s) 25, 295, 431
StyI CCWWGG 5 cut(s) 19, 214, 373, 470, 650
TaaI ACNGT 2 cut(s) 262, 590
TaqI TCGA 1 cut(s) 769
TasI AATT 4 cut(s) 81, 288, 521, 705
TfiI GAWTC 1 cut(s) 398
Tru1I TTAA 2 cut(s) 342, 782
Tru9I TTAA 2 cut(s) 342, 782
TscAI CASTG 2 cut(s) 267, 593
TseI GCWGC 9 cut(s) 137, 329, 428, 497, 512, 545, 548, 551, 656
TspDTI ATGAA 2 cut(s) 165, 390
TspRI CASTG 2 cut(s) 267, 593
VneI GTGCAC 1 cut(s) 584
VpaK11BI GGWCC 2 cut(s) 23, 710
XceI RCATGY 7 cut(s) 47, 198, 329, 359, 545, 665, 743
XspI CTAG 2 cut(s) 563, 618
Zsp2I ATGCAT 1 cut(s) 196
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.