Rmu_sc0006928.1_g000027

Stores iron in a soluble, non-toxic, readily available form. Important for iron homeostasis. Iron is taken up in the ferrous form and deposited as ferric hydroxides after oxidation

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006928.1
OG0003525
Physical Location & Seq
Forward (+)
97776 .. 99669
1894 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 831 bp
atgcctttgactataagcccttcttcaacatccataatctcccaaagaccaaaccttggtttcttcaaaaacactggaccagctttcattaaactcccaaagagcaacaacaatggcaacgtgggtagtggtggtttggtaatattcgcctcaaatggggctaataatcgacaagcactggaggtggtgttcgagccctttgaggaggtcaagaaggagctccttctcgtcccaactgagcctaatgcttctcttgctcgccagaaatacacagacgaaagtgtagctgccattaatgaacaaatcaatgtggaatacaatgtctcctatgtgtaccatgccatctatgcctactttgacagagacaatgttgctcttaagggatttgccaagtttttcaaagaatcaagcgcagaagaaagggggcatgctgaaaaactgatggaatatcagattttgatatataactatgttctcctgatgaccatataccagaacaaacgtggaggaagagttaagctacagtccatgctaatgccctgctcagagtttgatcatgctgagaagggtgatgcgttgcacgcaatggagcttgcgcttgctttggaaaagctgaacaatgagaaacttctaaatctgcacaaaatagctaatgaaaacaatgatgtgcatttagcggattacattgaaagtgaatacttgaatgaacaggtcgaatctataaggaaaatttctgaatatgtagctcagttgagaaggattggtccaggacatggtgtttggcactttgatcagatgctccttaatgacacagccggggtcgccgcatga

Protein Analysis

276

Amino Acids

31.05

Weight (kDa)

5.67

Isoelectric Point (pI)

37.25

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ferritin PF00210 96 - 254 1.8e-26 Ferritin-like domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 2 cut(s) 56, 773
AciI CCGC 2 cut(s) 677, 825
AcsI RAATTY 1 cut(s) 729
AfaI GTAC 1 cut(s) 335
AfiI CCNNNNNNNGG 3 cut(s) 56, 156, 773
AflII CTTAAG 1 cut(s) 377
AgsI TTSAA 5 cut(s) 27, 67, 400, 689, 703
AjnI CCWGG 1 cut(s) 766
AloI GAACNNNNNNTCC 2 cut(s) 173, 205
AluBI AGCT 8 cut(s) 83, 220, 287, 520, 592, 613, 650, 746
AluI AGCT 8 cut(s) 83, 220, 287, 520, 592, 613, 650, 746
Alw21I GWGCWC 1 cut(s) 222
Alw26I GTCTC 2 cut(s) 328, 357
ApeKI GCWGC 1 cut(s) 287
ApoI RAATTY 1 cut(s) 729
ArsI GACNNNNNNTTYG 2 cut(s) 762, 794
AseI ATTAAT 1 cut(s) 294
AspLEI GCGC 2 cut(s) 413, 598
AspS9I GGNCC 2 cut(s) 77, 764
AsuC2I CCSGG 1 cut(s) 817
AsuHPI GGTGA 1 cut(s) 581
AvaII GGWCC 2 cut(s) 77, 764
BanII GRGCYC 2 cut(s) 198, 222
Bbv12I GWGCWC 1 cut(s) 222
BbvI GCAGC 1 cut(s) 274
BccI CCATC 2 cut(s) 350, 436
BciT130I CCWGG 1 cut(s) 768
BclI TGATCA 2 cut(s) 553, 790
BcnI CCSGG 1 cut(s) 817
BcoDI GTCTC 2 cut(s) 328, 357
BfmI CTRYAG 1 cut(s) 521
BfrI CTTAAG 1 cut(s) 377
BisI GCNGC 2 cut(s) 288, 825
BlsI GCNGC 2 cut(s) 289, 826
Bme1390I CCNGG 2 cut(s) 768, 817
Bme18I GGWCC 2 cut(s) 77, 764
BmgT120I GGNCC 2 cut(s) 77, 764
BmrFI CCNGG 2 cut(s) 768, 817
BmsI GCATC 2 cut(s) 562, 786
BpmI CTGGAG 1 cut(s) 200
BpuMI CCSGG 1 cut(s) 817
BsaJI CCNNGG 2 cut(s) 55, 816
BsaXI ACNNNNNCTCC 6 cut(s) 173, 203, 308, 338, 498, 528
Bsc4I CCNNNNNNNGG 3 cut(s) 56, 156, 773
Bse1I ACTGG 2 cut(s) 79, 183
Bse3DI GCAATG 1 cut(s) 591
BseBI CCWGG 1 cut(s) 768
BseDI CCNNGG 2 cut(s) 55, 816
BseGI GGATG 1 cut(s) 29
BseLI CCNNNNNNNGG 3 cut(s) 56, 156, 773
BseMI GCAATG 1 cut(s) 591
BseMII CTCAG 4 cut(s) 228, 552, 558, 761
BseNI ACTGG 2 cut(s) 79, 183
BseRI GAGGAG 1 cut(s) 218
BseXI GCAGC 1 cut(s) 274
BsgI GTGCAG 1 cut(s) 623
BsiHKAI GWGCWC 1 cut(s) 222
BsiSI CCGG 1 cut(s) 816
BslFI GGGAC 1 cut(s) 215
BslI CCNNNNNNNGG 3 cut(s) 56, 156, 773
BsmAI GTCTC 2 cut(s) 328, 357
BsmFI GGGAC 1 cut(s) 215
Bsp1286I GDGCHC 2 cut(s) 198, 222
Bsp143I GATC 2 cut(s) 553, 790
BspACI CCGC 2 cut(s) 677, 825
BspCNI CTCAG 4 cut(s) 229, 553, 557, 760
BspTI CTTAAG 1 cut(s) 377
BsrDI GCAATG 1 cut(s) 591
BsrI ACTGG 2 cut(s) 79, 183
BssECI CCNNGG 2 cut(s) 55, 816
BssMI GATC 2 cut(s) 553, 790
BssT1I CCWWGG 1 cut(s) 55
Bst2UI CCWGG 1 cut(s) 768
Bst4CI ACNGT 1 cut(s) 525
Bst6I CTCTTC 1 cut(s) 505
BstAFI CTTAAG 1 cut(s) 377
BstC8I GCNNGC 5 cut(s) 259, 429, 582, 594, 600
BstDEI CTNAG 4 cut(s) 237, 544, 561, 747
BstF5I GGATG 1 cut(s) 29
BstHHI GCGC 2 cut(s) 413, 598
BstKTI GATC 2 cut(s) 556, 793
BstMAI GTCTC 2 cut(s) 328, 357
BstMBI GATC 2 cut(s) 553, 790
BstMWI GCNNNNNNNGC 4 cut(s) 254, 347, 581, 821
BstNI CCWGG 1 cut(s) 768
BstNSI RCATGY 1 cut(s) 431
BstSCI CCNGG 2 cut(s) 766, 815
BstSFI CTRYAG 1 cut(s) 521
BstV1I GCAGC 1 cut(s) 274
BtsCI GGATG 1 cut(s) 29
BtsIMutI CAGTG 2 cut(s) 72, 176
Cac8I GCNNGC 5 cut(s) 259, 429, 582, 594, 600
CfoI GCGC 2 cut(s) 413, 598
Cfr13I GGNCC 2 cut(s) 77, 764
Csp6I GTAC 1 cut(s) 334
CviAII CATG 6 cut(s) 338, 428, 529, 557, 773, 828
CviQI GTAC 1 cut(s) 334
DdeI CTNAG 4 cut(s) 237, 544, 561, 747
DpnI GATC 2 cut(s) 555, 792
DpnII GATC 2 cut(s) 553, 790
Eam1104I CTCTTC 1 cut(s) 505
EarI CTCTTC 1 cut(s) 505
Ecl136II GAGCTC 1 cut(s) 220
Eco130I CCWWGG 1 cut(s) 55
Eco24I GRGCYC 2 cut(s) 198, 222
Eco47I GGWCC 2 cut(s) 77, 764
Eco53kI GAGCTC 1 cut(s) 220
EcoICRI GAGCTC 1 cut(s) 220
EcoRII CCWGG 1 cut(s) 766
EcoT14I CCWWGG 1 cut(s) 55
EcoT38I GRGCYC 2 cut(s) 198, 222
ErhI CCWWGG 1 cut(s) 55
FaeI CATG 6 cut(s) 341, 431, 532, 560, 776, 831
FalI AAGNNNNNCTT 2 cut(s) 7, 39
FaqI GGGAC 1 cut(s) 215
FatI CATG 6 cut(s) 337, 427, 528, 556, 772, 827
FbaI TGATCA 2 cut(s) 553, 790
Fnu4HI GCNGC 2 cut(s) 288, 825
FokI GGATG 1 cut(s) 16
FriOI GRGCYC 2 cut(s) 198, 222
Fsp4HI GCNGC 2 cut(s) 288, 825
GlaI GCGC 2 cut(s) 412, 597
GluI GCNGC 2 cut(s) 288, 825
GsuI CTGGAG 1 cut(s) 200
HapII CCGG 1 cut(s) 816
HhaI GCGC 2 cut(s) 413, 598
Hin1II CATG 6 cut(s) 341, 431, 532, 560, 776, 831
Hin6I GCGC 2 cut(s) 411, 596
HinP1I GCGC 2 cut(s) 411, 596
HinfI GANTC 2 cut(s) 404, 716
HpaII CCGG 1 cut(s) 816
HphI GGTGA 1 cut(s) 581
Hpy166II GTNNAC 1 cut(s) 334
Hpy188I TCNGA 4 cut(s) 453, 547, 736, 795
Hpy188III TCNNGA 2 cut(s) 211, 478
Hpy8I GTNNAC 1 cut(s) 334
HpyAV CCTTC 5 cut(s) 30, 208, 233, 559, 750
HpyCH4III ACNGT 1 cut(s) 525
HpyCH4IV ACGT 2 cut(s) 120, 502
HpyCH4V TGCA 3 cut(s) 580, 640, 670
HpyF10VI GCNNNNNNNGC 4 cut(s) 254, 347, 581, 821
HpyF3I CTNAG 4 cut(s) 237, 544, 561, 747
HpySE526I ACGT 2 cut(s) 120, 502
Hsp92II CATG 6 cut(s) 341, 431, 532, 560, 776, 831
HspAI GCGC 2 cut(s) 411, 596
Ksp22I TGATCA 2 cut(s) 553, 790
Kzo9I GATC 2 cut(s) 553, 790
LmnI GCTCC 4 cut(s) 217, 225, 589, 804
Lsp1109I GCAGC 1 cut(s) 274
LweI GCATC 2 cut(s) 562, 786
MaeII ACGT 2 cut(s) 120, 502
MalI GATC 2 cut(s) 555, 792
MboI GATC 2 cut(s) 553, 790
MboII GAAGA 4 cut(s) 15, 55, 428, 522
MhlI GDGCHC 2 cut(s) 198, 222
MluCI AATT 1 cut(s) 729
MnlI CCTC 5 cut(s) 160, 175, 196, 199, 500
MseI TTAA 5 cut(s) 90, 294, 378, 516, 804
MslI CAYNNNNRTG 1 cut(s) 533
MspCI CTTAAG 1 cut(s) 377
MspI CCGG 1 cut(s) 816
MspR9I CCNGG 2 cut(s) 768, 817
MvaI CCWGG 1 cut(s) 768
MwoI GCNNNNNNNGC 4 cut(s) 254, 347, 581, 821
NciI CCSGG 1 cut(s) 817
NdeII GATC 2 cut(s) 553, 790
NlaIII CATG 6 cut(s) 341, 431, 532, 560, 776, 831
NspI RCATGY 1 cut(s) 431
PaeI GCATGC 1 cut(s) 431
PfeI GAWTC 2 cut(s) 404, 716
PflMI CCANNNNNTGG 2 cut(s) 56, 773
PfoI TCCNGGA 1 cut(s) 766
PkrI GCNGC 2 cut(s) 289, 826
PshBI ATTAAT 1 cut(s) 294
Psp124BI GAGCTC 1 cut(s) 222
Psp6I CCWGG 1 cut(s) 766
PspGI CCWGG 1 cut(s) 766
PspPI GGNCC 2 cut(s) 77, 764
RsaI GTAC 1 cut(s) 335
RsaNI GTAC 1 cut(s) 334
RseI CAYNNNNRTG 1 cut(s) 533
SacI GAGCTC 1 cut(s) 222
SaqAI TTAA 5 cut(s) 90, 294, 378, 516, 804
SatI GCNGC 2 cut(s) 288, 825
Sau3AI GATC 2 cut(s) 553, 790
Sau96I GGNCC 2 cut(s) 77, 764
ScrFI CCNGG 2 cut(s) 768, 817
SduI GDGCHC 2 cut(s) 198, 222
SfaNI GCATC 2 cut(s) 562, 786
SfcI CTRYAG 1 cut(s) 521
SinI GGWCC 2 cut(s) 77, 764
SmiMI CAYNNNNRTG 1 cut(s) 533
SmlI CTYRAG 1 cut(s) 377
SmoI CTYRAG 1 cut(s) 377
SphI GCATGC 1 cut(s) 431
Sse9I AATT 1 cut(s) 729
SsiI CCGC 2 cut(s) 677, 825
SspI AATATT 1 cut(s) 144
SstI GAGCTC 1 cut(s) 222
StyD4I CCNGG 2 cut(s) 766, 815
StyI CCWWGG 1 cut(s) 55
TaaI ACNGT 1 cut(s) 525
TaiI ACGT 2 cut(s) 123, 505
TaqI TCGA 3 cut(s) 169, 192, 714
TasI AATT 1 cut(s) 729
TauI GCSGC 1 cut(s) 827
TfiI GAWTC 2 cut(s) 404, 716
Tru1I TTAA 5 cut(s) 90, 294, 378, 516, 804
Tru9I TTAA 5 cut(s) 90, 294, 378, 516, 804
TscAI CASTG 2 cut(s) 79, 183
TseI GCWGC 1 cut(s) 287
TspDTI ATGAA 4 cut(s) 76, 312, 669, 720
TspRI CASTG 2 cut(s) 79, 183
Van91I CCANNNNNTGG 2 cut(s) 56, 773
Vha464I CTTAAG 1 cut(s) 377
VpaK11BI GGWCC 2 cut(s) 77, 764
VspI ATTAAT 1 cut(s) 294
XapI RAATTY 1 cut(s) 729
XceI RCATGY 1 cut(s) 431
XcmI CCANNNNNNNNNTGG 1 cut(s) 500
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.