Rmu_sc0007782.1_g000018

ATP-dependent Clp protease proteolytic subunit

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0007782.1
Physical Location & Seq
Forward (+)
86333 .. 86749
417 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0007782.1_g000018.1.cds

Sequence Viewer

Length: 417 bp
atgatgacatatggagcctcagcttcaaggcctctctgcttcaacacccaaccggccattgtcaagagcaatggtcttaatagcactagcgcttctagaaggaggaggcgcgtcggtctggttagagcctcgtcgcctacaagactcacaagacccaccttgtccagcaattgggattttcatttcgccactactactactacttcagttccacgcgtccccagattcaaagagctcgataccaccaacatgctcctccatgagagcatcatcttgggttctcatgtttcattttcatttgaattattgaaatgggttttggaaaatcttgtgaatttttgtactctcgtgtttgttggaagcttaattgaattgttagaatatggaatttgtgggttttgtttcattgagttttga

Protein Analysis

138

Amino Acids

15.53

Weight (kDa)

9.43

Isoelectric Point (pI)

39.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 171
AccII CGCG 2 cut(s) 111, 216
AcoI YGGCCR 1 cut(s) 54
AcsI RAATTY 2 cut(s) 334, 387
AcuI CTGAAG 1 cut(s) 189
AfaI GTAC 1 cut(s) 343
AfeI AGCGCT 1 cut(s) 91
AfiI CCNNNNNNNGG 1 cut(s) 171
AflIII ACRYGT 1 cut(s) 214
AgsI TTSAA 6 cut(s) 27, 43, 229, 302, 310, 371
AjuI GAANNNNNNNTTGG 2 cut(s) 302, 334
AluBI AGCT 3 cut(s) 23, 235, 363
AluI AGCT 3 cut(s) 23, 235, 363
Alw21I GWGCWC 1 cut(s) 237
Aor51HI AGCGCT 1 cut(s) 91
AoxI GGCC 2 cut(s) 29, 54
ApoI RAATTY 2 cut(s) 334, 387
AspLEI GCGC 2 cut(s) 92, 111
BanII GRGCYC 1 cut(s) 237
BauI CACGAG 1 cut(s) 347
Bbv12I GWGCWC 1 cut(s) 237
BbvCI CCTCAGC 1 cut(s) 19
BfaI CTAG 2 cut(s) 87, 96
BfoI RGCGCY 1 cut(s) 93
BmiI GGNNCC 1 cut(s) 16
BmsI GCATC 1 cut(s) 276
Bpu10I CCTNAGC 1 cut(s) 19
Bsc4I CCNNNNNNNGG 1 cut(s) 171
Bse118I RCCGGY 1 cut(s) 52
Bse3DI GCAATG 1 cut(s) 76
BseLI CCNNNNNNNGG 1 cut(s) 171
BseMI GCAATG 1 cut(s) 76
BseMII CTCAG 1 cut(s) 33
BseRI GAGGAG 2 cut(s) 118, 245
Bsh1236I CGCG 2 cut(s) 111, 216
BshFI GGCC 2 cut(s) 31, 56
BsiHKAI GWGCWC 1 cut(s) 237
BsiSI CCGG 1 cut(s) 53
BslFI GGGAC 1 cut(s) 203
BslI CCNNNNNNNGG 1 cut(s) 171
BsmFI GGGAC 1 cut(s) 203
BsnI GGCC 2 cut(s) 31, 56
Bsp1286I GDGCHC 1 cut(s) 237
BspANI GGCC 2 cut(s) 31, 56
BspCNI CTCAG 1 cut(s) 32
BspFNI CGCG 2 cut(s) 111, 216
BspLI GGNNCC 1 cut(s) 16
BsrDI GCAATG 1 cut(s) 76
BsrFI RCCGGY 1 cut(s) 52
BssAI RCCGGY 1 cut(s) 52
BssSI CACGAG 1 cut(s) 347
Bst2BI CACGAG 1 cut(s) 347
BstDEI CTNAG 1 cut(s) 19
BstFNI CGCG 2 cut(s) 111, 216
BstH2I RGCGCY 1 cut(s) 93
BstHHI GCGC 2 cut(s) 92, 111
BstNSI RCATGY 1 cut(s) 253
BstUI CGCG 2 cut(s) 111, 216
BsuRI GGCC 2 cut(s) 31, 56
CfoI GCGC 2 cut(s) 92, 111
Cfr10I RCCGGY 1 cut(s) 52
CseI GACGC 2 cut(s) 100, 205
Csp6I GTAC 1 cut(s) 342
CviAII CATG 3 cut(s) 250, 260, 284
CviJI RGCY 7 cut(s) 17, 23, 31, 56, 128, 235, 363
CviKI_1 RGCY 7 cut(s) 17, 23, 31, 56, 128, 235, 363
CviQI GTAC 1 cut(s) 342
DdeI CTNAG 1 cut(s) 19
EaeI YGGCCR 1 cut(s) 54
Ecl136II GAGCTC 1 cut(s) 235
Eco147I AGGCCT 1 cut(s) 31
Eco24I GRGCYC 1 cut(s) 237
Eco47III AGCGCT 1 cut(s) 91
Eco53kI GAGCTC 1 cut(s) 235
Eco57I CTGAAG 1 cut(s) 189
EcoICRI GAGCTC 1 cut(s) 235
EcoT38I GRGCYC 1 cut(s) 237
FaeI CATG 3 cut(s) 253, 263, 287
FaiI YATR 6 cut(s) 10, 12, 251, 261, 285, 384
FaqI GGGAC 1 cut(s) 203
FatI CATG 3 cut(s) 249, 259, 283
FauNDI CATATG 1 cut(s) 10
FriOI GRGCYC 1 cut(s) 237
FspBI CTAG 2 cut(s) 87, 96
GlaI GCGC 2 cut(s) 91, 110
HaeII RGCGCY 1 cut(s) 93
HaeIII GGCC 2 cut(s) 31, 56
HapII CCGG 1 cut(s) 53
HgaI GACGC 2 cut(s) 100, 205
HhaI GCGC 2 cut(s) 92, 111
Hin1II CATG 3 cut(s) 253, 263, 287
Hin6I GCGC 2 cut(s) 90, 109
HinP1I GCGC 2 cut(s) 90, 109
HindIII AAGCTT 1 cut(s) 361
HinfI GANTC 2 cut(s) 144, 225
HpaII CCGG 1 cut(s) 53
Hpy188III TCNNGA 2 cut(s) 64, 96
Hpy99I CGWCG 2 cut(s) 116, 136
HpyAV CCTTC 1 cut(s) 93
HpyF3I CTNAG 1 cut(s) 19
Hsp92II CATG 3 cut(s) 253, 263, 287
HspAI GCGC 2 cut(s) 90, 109
LmnI GCTCC 2 cut(s) 14, 258
LpnPI CCDG 4 cut(s) 66, 104, 178, 235
LweI GCATC 1 cut(s) 276
MaeI CTAG 2 cut(s) 87, 96
MfeI CAATTG 1 cut(s) 169
MhlI GDGCHC 1 cut(s) 237
MluCI AATT 6 cut(s) 169, 302, 334, 366, 371, 387
MluI ACGCGT 1 cut(s) 214
MlyI GAGTC 1 cut(s) 138
MmeI TCCRAC 1 cut(s) 337
MnlI CCTC 6 cut(s) 28, 42, 96, 99, 139, 266
MseI TTAA 2 cut(s) 78, 365
MslI CAYNNNNRTG 1 cut(s) 248
MspI CCGG 1 cut(s) 53
MunI CAATTG 1 cut(s) 169
MvnI CGCG 2 cut(s) 111, 216
NdeI CATATG 1 cut(s) 10
NlaIII CATG 3 cut(s) 253, 263, 287
NlaIV GGNNCC 1 cut(s) 16
NspI RCATGY 1 cut(s) 253
PceI AGGCCT 1 cut(s) 31
PfeI GAWTC 1 cut(s) 225
PflMI CCANNNNNTGG 1 cut(s) 171
PleI GAGTC 1 cut(s) 138
PpsI GAGTC 1 cut(s) 138
Psp124BI GAGCTC 1 cut(s) 237
PspN4I GGNNCC 1 cut(s) 16
RsaI GTAC 1 cut(s) 343
RsaNI GTAC 1 cut(s) 342
RseI CAYNNNNRTG 1 cut(s) 248
SacI GAGCTC 1 cut(s) 237
SaqAI TTAA 2 cut(s) 78, 365
SchI GAGTC 1 cut(s) 138
SduI GDGCHC 1 cut(s) 237
SetI ASST 4 cut(s) 25, 161, 237, 365
SfaNI GCATC 1 cut(s) 276
SmiMI CAYNNNNRTG 1 cut(s) 248
Sse9I AATT 6 cut(s) 169, 302, 334, 366, 371, 387
SseBI AGGCCT 1 cut(s) 31
SspMI CTAG 2 cut(s) 87, 96
SstI GAGCTC 1 cut(s) 237
StuI AGGCCT 1 cut(s) 31
TaqI TCGA 1 cut(s) 237
TaqII GACCGA 1 cut(s) 104
TasI AATT 6 cut(s) 169, 302, 334, 366, 371, 387
TatI WGTACW 1 cut(s) 341
TfiI GAWTC 1 cut(s) 225
Tru1I TTAA 2 cut(s) 78, 365
Tru9I TTAA 2 cut(s) 78, 365
TspDTI ATGAA 4 cut(s) 170, 279, 285, 394
Van91I CCANNNNNTGG 1 cut(s) 171
XapI RAATTY 2 cut(s) 334, 387
XbaI TCTAGA 1 cut(s) 95
XceI RCATGY 1 cut(s) 253
XspI CTAG 2 cut(s) 87, 96
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.