Rmu_sc0010151.1_g000004

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0010151.1
Physical Location & Seq
Forward (+)
14033 .. 14314
282 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0010151.1_g000004.1.cds

Sequence Viewer

Length: 282 bp
atggagttaggttcactagaatcacagtcttacgtgctattgtcaagcatctatacttccctgggtaggcgggaagatgttgagcgggtaaggaggatgatgaaacttcgaggggtgagtaagaaggctggctgtagctggattgagttgaagagtcaggttcatgtgtttgttgttggtgatttgatgcatccacagattgatagtataggtgttgagatccgaaggttaatcaagcatatgaaggatgaaggataccaaacttcctctatcactttttga

Protein Analysis

93

Amino Acids

10.67

Weight (kDa)

9.25

Isoelectric Point (pI)

58.19

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 85
AciI CCGC 2 cut(s) 70, 85
AclWI GGATC 1 cut(s) 214
AfiI CCNNNNNNNGG 1 cut(s) 66
AgsI TTSAA 1 cut(s) 151
AjnI CCWGG 1 cut(s) 60
AluBI AGCT 1 cut(s) 138
AluI AGCT 1 cut(s) 138
AlwI GGATC 1 cut(s) 214
AsuHPI GGTGA 2 cut(s) 127, 191
BciT130I CCWGG 1 cut(s) 62
BciVI GTATCC 1 cut(s) 248
BfaI CTAG 1 cut(s) 17
BfmI CTRYAG 1 cut(s) 133
BfuI GTATCC 1 cut(s) 248
Bme1390I CCNGG 1 cut(s) 62
BmrFI CCNGG 1 cut(s) 62
BmsI GCATC 3 cut(s) 57, 177, 199
BsaAI YACGTR 1 cut(s) 34
BsaJI CCNNGG 2 cut(s) 60, 61
Bsc4I CCNNNNNNNGG 1 cut(s) 66
BseBI CCWGG 1 cut(s) 62
BseDI CCNNGG 2 cut(s) 60, 61
BseGI GGATG 3 cut(s) 102, 190, 253
BseLI CCNNNNNNNGG 1 cut(s) 66
BslI CCNNNNNNNGG 1 cut(s) 66
Bsp143I GATC 1 cut(s) 219
BspACI CCGC 2 cut(s) 70, 85
BspPI GGATC 1 cut(s) 214
BsrBI CCGCTC 1 cut(s) 85
BssECI CCNNGG 2 cut(s) 60, 61
BssMI GATC 1 cut(s) 219
Bst2UI CCWGG 1 cut(s) 62
Bst4CI ACNGT 1 cut(s) 27
Bst6I CTCTTC 1 cut(s) 146
BstBAI YACGTR 1 cut(s) 34
BstC8I GCNNGC 1 cut(s) 130
BstF5I GGATG 3 cut(s) 102, 190, 253
BstKTI GATC 1 cut(s) 222
BstMBI GATC 1 cut(s) 219
BstNI CCWGG 1 cut(s) 62
BstSCI CCNGG 1 cut(s) 60
BstSFI CTRYAG 1 cut(s) 133
BstX2I RGATCY 1 cut(s) 219
BstYI RGATCY 1 cut(s) 219
BsuI GTATCC 1 cut(s) 248
BtsCI GGATG 3 cut(s) 102, 190, 253
Cac8I GCNNGC 1 cut(s) 130
CviAII CATG 1 cut(s) 164
CviJI RGCY 3 cut(s) 128, 132, 138
CviKI_1 RGCY 3 cut(s) 128, 132, 138
DpnI GATC 1 cut(s) 221
DpnII GATC 1 cut(s) 219
Eam1104I CTCTTC 1 cut(s) 146
EarI CTCTTC 1 cut(s) 146
EcoRII CCWGG 1 cut(s) 60
EcoT22I ATGCAT 1 cut(s) 192
FaeI CATG 1 cut(s) 167
FaiI YATR 5 cut(s) 54, 165, 209, 240, 242
FatI CATG 1 cut(s) 163
FauI CCCGC 2 cut(s) 63, 78
FauNDI CATATG 1 cut(s) 240
FokI GGATG 3 cut(s) 109, 177, 260
FspBI CTAG 1 cut(s) 17
Hin1II CATG 1 cut(s) 167
HinfI GANTC 2 cut(s) 20, 154
HphI GGTGA 2 cut(s) 127, 191
Hpy166II GTNNAC 1 cut(s) 14
Hpy188I TCNGA 1 cut(s) 224
Hpy8I GTNNAC 1 cut(s) 14
HpyAV CCTTC 4 cut(s) 118, 219, 238, 245
HpyCH4III ACNGT 1 cut(s) 27
HpyCH4IV ACGT 1 cut(s) 33
HpyCH4V TGCA 1 cut(s) 190
HpySE526I ACGT 1 cut(s) 33
Hsp92II CATG 1 cut(s) 167
Kzo9I GATC 1 cut(s) 219
LpnPI CCDG 5 cut(s) 47, 74, 114, 124, 143
LweI GCATC 3 cut(s) 57, 177, 199
MaeI CTAG 1 cut(s) 17
MaeII ACGT 1 cut(s) 33
MalI GATC 1 cut(s) 221
MbiI CCGCTC 1 cut(s) 85
MboI GATC 1 cut(s) 219
MboII GAAGA 2 cut(s) 86, 163
MflI RGATCY 1 cut(s) 219
MlyI GAGTC 1 cut(s) 163
MnlI CCTC 3 cut(s) 87, 104, 277
Mph1103I ATGCAT 1 cut(s) 192
MseI TTAA 1 cut(s) 230
MspR9I CCNGG 1 cut(s) 62
MvaI CCWGG 1 cut(s) 62
NdeI CATATG 1 cut(s) 240
NdeII GATC 1 cut(s) 219
NlaIII CATG 1 cut(s) 167
NsiI ATGCAT 1 cut(s) 192
PasI CCCWGGG 1 cut(s) 61
PfeI GAWTC 1 cut(s) 20
PleI GAGTC 1 cut(s) 162
PpsI GAGTC 1 cut(s) 162
Ppu21I YACGTR 1 cut(s) 34
Psp6I CCWGG 1 cut(s) 60
PspGI CCWGG 1 cut(s) 60
PsuI RGATCY 1 cut(s) 219
SaqAI TTAA 1 cut(s) 230
Sau3AI GATC 1 cut(s) 219
SchI GAGTC 1 cut(s) 163
ScrFI CCNGG 1 cut(s) 62
SetI ASST 6 cut(s) 13, 36, 140, 162, 214, 230
SfaNI GCATC 3 cut(s) 57, 177, 199
SfcI CTRYAG 1 cut(s) 133
SsiI CCGC 2 cut(s) 70, 85
SspMI CTAG 1 cut(s) 17
StyD4I CCNGG 1 cut(s) 60
TaaI ACNGT 1 cut(s) 27
TaiI ACGT 1 cut(s) 36
TaqI TCGA 1 cut(s) 109
TfiI GAWTC 1 cut(s) 20
Tru1I TTAA 1 cut(s) 230
Tru9I TTAA 1 cut(s) 230
TspDTI ATGAA 4 cut(s) 116, 152, 257, 264
XspI CTAG 1 cut(s) 17
Zsp2I ATGCAT 1 cut(s) 192
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.