Rh3CG329400

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3C
Physical Location & Seq
Reverse (-)
36490397 .. 36490597
201 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3CG329400.1

Sequence Viewer

Length: 171 bp
ATGTTTGGCACCCCTGTTGAGGTTCAAGCTGATAATGTTGAACCTGAAGCTGTTCCAGTAGAGAATGTTCAAGAATATGTTCCGGTAGATAATGTTCAAGAAGATGTTCCATCCCCTGCTCCAGCTCCTGCTTATGTGCCTAATATGGCATCACAACAATCCAGCAATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

56

Amino Acids

5.98

Weight (kDa)

4.05

Isoelectric Point (pI)

93.89

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 8
AcuI CTGAAG 1 cut(s) 66
AfiI CCNNNNNNNGG 1 cut(s) 19
AgsI TTSAA 4 cut(s) 26, 41, 71, 98
AluBI AGCT 3 cut(s) 29, 50, 125
AluI AGCT 3 cut(s) 29, 50, 125
AlwNI CAGNNNCTG 1 cut(s) 128
Asp700I GAANNNNTTC 3 cut(s) 51, 78, 105
BanI GGYRCC 1 cut(s) 8
BccI CCATC 1 cut(s) 118
BmiI GGNNCC 1 cut(s) 10
BmsI GCATC 1 cut(s) 158
BpmI CTGGAG 1 cut(s) 105
BsaWI WCCGGW 1 cut(s) 82
Bsc4I CCNNNNNNNGG 1 cut(s) 19
Bse1I ACTGG 1 cut(s) 56
BseGI GGATG 1 cut(s) 110
BseLI CCNNNNNNNGG 1 cut(s) 19
BseNI ACTGG 1 cut(s) 56
BshNI GGYRCC 1 cut(s) 8
BsiSI CCGG 1 cut(s) 83
BslI CCNNNNNNNGG 1 cut(s) 19
BspLI GGNNCC 1 cut(s) 10
BspT107I GGYRCC 1 cut(s) 8
BsrI ACTGG 1 cut(s) 56
BstF5I GGATG 1 cut(s) 110
BtsCI GGATG 1 cut(s) 110
CaiI CAGNNNCTG 1 cut(s) 128
CviJI RGCY 3 cut(s) 29, 50, 125
CviKI_1 RGCY 3 cut(s) 29, 50, 125
Eco57I CTGAAG 1 cut(s) 66
FaiI YATR 3 cut(s) 78, 135, 146
FokI GGATG 1 cut(s) 97
GsuI CTGGAG 1 cut(s) 105
HapII CCGG 1 cut(s) 83
HpaII CCGG 1 cut(s) 83
Hpy188III TCNNGA 2 cut(s) 71, 98
LmnI GCTCC 2 cut(s) 124, 130
LpnPI CCDG 7 cut(s) 27, 57, 69, 96, 129, 135, 141
LweI GCATC 1 cut(s) 158
MboII GAAGA 1 cut(s) 113
MluCI AATT 1 cut(s) 166
MnlI CCTC 1 cut(s) 13
MroXI GAANNNNTTC 3 cut(s) 51, 78, 105
MseI TTAA 1 cut(s) 169
MspI CCGG 1 cut(s) 83
NlaIV GGNNCC 1 cut(s) 10
PdmI GAANNNNTTC 3 cut(s) 51, 78, 105
PspN4I GGNNCC 1 cut(s) 10
PsrI GAACNNNNNNTAC 4 cut(s) 51, 78, 83, 110
PstNI CAGNNNCTG 1 cut(s) 128
SaqAI TTAA 1 cut(s) 169
SetI ASST 5 cut(s) 24, 31, 46, 52, 127
SfaNI GCATC 1 cut(s) 158
Sse9I AATT 1 cut(s) 166
TasI AATT 1 cut(s) 166
Tru1I TTAA 1 cut(s) 169
Tru9I TTAA 1 cut(s) 169
XmnI GAANNNNTTC 3 cut(s) 51, 78, 105
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.