Rh2AG148500

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
Physical Location & Seq
Reverse (-)
13566368 .. 13579945
13578 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG148500.1

Sequence Viewer

Length: 177 bp
ATGGCCCAGCCACCATCTGGTGAGGTTCAAGCTGATAATGTTGAACCTGAAGCTATTCCAACAAAGAATGTTCAAGAAGATGTTCCAGCCCCTGATCCAGCTCCTGCTGATGTGCCTAATGTGAGGCAGCTTCACCAAACAGTTCTCACATTCACAACCCAGATTCAGTTGTTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

58

Amino Acids

6.26

Weight (kDa)

4.07

Isoelectric Point (pI)

56.24

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 17
AclWI GGATC 1 cut(s) 89
AcuI CTGAAG 1 cut(s) 69
AfiI CCNNNNNNNGG 1 cut(s) 17
AgsI TTSAA 3 cut(s) 29, 44, 74
AluBI AGCT 4 cut(s) 32, 53, 101, 130
AluI AGCT 4 cut(s) 32, 53, 101, 130
AlwI GGATC 1 cut(s) 89
AlwNI CAGNNNCTG 2 cut(s) 92, 104
AoxI GGCC 1 cut(s) 3
ApeKI GCWGC 1 cut(s) 127
Asp700I GAANNNNTTC 2 cut(s) 54, 81
AspS9I GGNCC 1 cut(s) 4
AsuHPI GGTGA 2 cut(s) 32, 125
BbvI GCAGC 1 cut(s) 139
BccI CCATC 1 cut(s) 22
BisI GCNGC 1 cut(s) 128
BlsI GCNGC 1 cut(s) 129
BmgT120I GGNCC 1 cut(s) 4
Bsc4I CCNNNNNNNGG 1 cut(s) 17
BseLI CCNNNNNNNGG 1 cut(s) 17
BseXI GCAGC 1 cut(s) 139
BseYI CCCAGC 1 cut(s) 6
BshFI GGCC 1 cut(s) 5
BslI CCNNNNNNNGG 1 cut(s) 17
BsnI GGCC 1 cut(s) 5
Bsp143I GATC 1 cut(s) 94
BspANI GGCC 1 cut(s) 5
BspPI GGATC 1 cut(s) 89
BssMI GATC 1 cut(s) 94
Bst4CI ACNGT 1 cut(s) 142
BstKTI GATC 1 cut(s) 97
BstMBI GATC 1 cut(s) 94
BstV1I GCAGC 1 cut(s) 139
BsuRI GGCC 1 cut(s) 5
CaiI CAGNNNCTG 2 cut(s) 92, 104
Cfr13I GGNCC 1 cut(s) 4
CviJI RGCY 7 cut(s) 5, 10, 32, 53, 89, 101, 130
CviKI_1 RGCY 7 cut(s) 5, 10, 32, 53, 89, 101, 130
DpnI GATC 1 cut(s) 96
DpnII GATC 1 cut(s) 94
Eco57I CTGAAG 1 cut(s) 69
Fnu4HI GCNGC 1 cut(s) 128
Fsp4HI GCNGC 1 cut(s) 128
GluI GCNGC 1 cut(s) 128
GsaI CCCAGC 1 cut(s) 10
HaeIII GGCC 1 cut(s) 5
HinfI GANTC 1 cut(s) 163
HphI GGTGA 2 cut(s) 32, 125
Hpy188III TCNNGA 1 cut(s) 74
HpyCH4III ACNGT 1 cut(s) 142
Kzo9I GATC 1 cut(s) 94
LmnI GCTCC 1 cut(s) 106
LpnPI CCDG 8 cut(s) 3, 20, 60, 99, 105, 111, 117, 173
Lsp1109I GCAGC 1 cut(s) 139
MalI GATC 1 cut(s) 96
MboI GATC 1 cut(s) 94
MboII GAAGA 1 cut(s) 89
MmeI TCCRAC 1 cut(s) 83
MnlI CCTC 2 cut(s) 16, 117
MroXI GAANNNNTTC 2 cut(s) 54, 81
NdeII GATC 1 cut(s) 94
PdmI GAANNNNTTC 2 cut(s) 54, 81
PfeI GAWTC 1 cut(s) 163
PflMI CCANNNNNTGG 1 cut(s) 17
PkrI GCNGC 1 cut(s) 129
PspFI CCCAGC 1 cut(s) 6
PspPI GGNCC 1 cut(s) 4
PstNI CAGNNNCTG 2 cut(s) 92, 104
SatI GCNGC 1 cut(s) 128
Sau3AI GATC 1 cut(s) 94
Sau96I GGNCC 1 cut(s) 4
SetI ASST 6 cut(s) 27, 34, 49, 55, 103, 132
TaaI ACNGT 1 cut(s) 142
TfiI GAWTC 1 cut(s) 163
TseI GCWGC 1 cut(s) 127
Van91I CCANNNNNTGG 1 cut(s) 17
XcmI CCANNNNNNNNNTGG 1 cut(s) 14
XmnI GAANNNNTTC 2 cut(s) 54, 81
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.