Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0012042.1

Orthogroup ID

OG0004377

Physical Location & Seq

Genomic Coordinates Forward (+)

11293 .. 13390

Gene Structure 2098 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0012042.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 681 bp

atgggtgctgcactaggttactggattgggaggaagcttttcatctcaaaggatggaacagtagatgttgttgtagcccaatttgctatgtgggcaatccgcttttttggaatcacgttcatctctcagagcactcttgatactcctttggctattggagcgttgctttcctgcttggttatctgcaaacttatcacttttgtgaagtggcatggtagaatgaatcagtcaaatggtgcgagtgggagtcctttacagcagaaaggaagacacgtcacaggaagacacagtcgtccagagttccttagcaggtccagcgcactagaggcatggaacagtacaaggggtacatctgcttggtctgattctcctgttaaaggtgttgtgtcgccatcttttaggacatgtgatcaacaggagtactattcaaccttccacaagttgcgaaaccgaaagaagttcacaaagaaagagtgggatgattttacaatggaatcaacgcggcatgctctagcagaatgggcagcatctcctgaattcaccgattgggttatcgagcatgccgaccgcatacaactccttccaagcgatagttcagatgaaactgtaggaagtgaatctgattctactgatgacaatgtcgtagggagcacggataggtgtggttttctcaaatggtag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

NEMP

Protein Analysis

226

Amino Acids

25.32

Weight (kDa)

7.72

Isoelectric Point (pI)

41.27

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004377)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G28760
fragaria_vesca	FvH4_1g28540 FvH4_1g28540 FvH4_1g28540
malus_domestica	MD09G1231100.v1.1 MD12G1009700.v1.1 MD12G1009900.v1.1 MD14G1007100.v1.1
prunus_persica	Prupe.7G011900_v2.0.a1
pyrus_communis	pycom09g15000 pycom12g00750 pycom14g00560
rosa_chinensis	RchiOBHm_Chr3g0496221 RchiOBHm_Chr7g0220041
rosa_laevigata	RLG00000022546
rosa_multiflora	Rmu_sc0004080.1_g000008 Rmu_sc0012042.1_g000001
rosa_roxburghii	Rroxscaffold_2G00132890 Rroxscaffold_6G00389440
rosa_rugosa	Rorug03G0280700
rosa_samantha	Rh2BG396500 Rh3AG327700 Rh3BG363700 Rh3CG360700 Rh3DG363800 Rh4AG043100 Rh5AG246200 Rh5AG289100 Rh6AG095200 Rh6CG082300 Rh6DG078000
rosa_wichuraiana	Rw3G028700

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	291
Acc36I	ACCTGC	1 cut(s)	300
AccII	CGCG	1 cut(s)	502
AciI	CCGC	3 cut(s)	100, 502, 568
AcsI	RAATTY	1 cut(s)	536
AfaI	GTAC	3 cut(s)	340, 349, 422
AfiI	CCNNNNNNNGG	1 cut(s)	377
AflIII	ACRYGT	2 cut(s)	271, 404
AgsI	TTSAA	1 cut(s)	429
AjiI	CACGTC	1 cut(s)	274
AjuI	GAANNNNNNNTTGG	2 cut(s)	577, 609
AleI	CACNNNNGTG	1 cut(s)	200
AluBI	AGCT	1 cut(s)	37
AluI	AGCT	1 cut(s)	37
Alw21I	GWGCWC	2 cut(s)	134, 653
ApeKI	GCWGC	2 cut(s)	8, 524
ApoI	RAATTY	1 cut(s)	536
Asp700I	GAANNNNTTC	1 cut(s)	38
AspLEI	GCGC	1 cut(s)	320
AspS9I	GGNCC	1 cut(s)	312
AsuHPI	GGTGA	1 cut(s)	532
AvaII	GGWCC	1 cut(s)	312
BbsI	GAAGAC	2 cut(s)	274, 289
Bbv12I	GWGCWC	2 cut(s)	134, 653
BbvI	GCAGC	1 cut(s)	536
BccI	CCATC	2 cut(s)	47, 400
BclI	TGATCA	1 cut(s)	409
BfaI	CTAG	3 cut(s)	14, 323, 512
BfmI	CTRYAG	1 cut(s)	606
BfuAI	ACCTGC	1 cut(s)	300
BisI	GCNGC	3 cut(s)	9, 503, 525
BlsI	GCNGC	3 cut(s)	10, 504, 526
BmcAI	AGTACT	1 cut(s)	422
Bme18I	GGWCC	1 cut(s)	312
BmgBI	CACGTC	1 cut(s)	274
BmgT120I	GGNCC	1 cut(s)	312
BmsI	GCATC	1 cut(s)	536
BpiI	GAAGAC	2 cut(s)	274, 289
Bpu10I	CCTNAGC	1 cut(s)	305
Bsc4I	CCNNNNNNNGG	1 cut(s)	377
Bse1I	ACTGG	1 cut(s)	26
BseGI	GGATG	2 cut(s)	58, 484
BseLI	CCNNNNNNNGG	1 cut(s)	377
BseMII	CTCAG	1 cut(s)	140
BseNI	ACTGG	1 cut(s)	26
BseXI	GCAGC	1 cut(s)	536
Bsh1236I	CGCG	1 cut(s)	502
Bsh1285I	CGRYCG	1 cut(s)	568
BsiEI	CGRYCG	1 cut(s)	568
BsiHKAI	GWGCWC	2 cut(s)	134, 653
BslI	CCNNNNNNNGG	1 cut(s)	377
Bsp1286I	GDGCHC	2 cut(s)	134, 653
Bsp143I	GATC	1 cut(s)	409
BspACI	CCGC	3 cut(s)	100, 502, 568
BspCNI	CTCAG	1 cut(s)	139
BspFNI	CGCG	1 cut(s)	502
BspMI	ACCTGC	1 cut(s)	300
BsrI	ACTGG	1 cut(s)	26
BssMI	GATC	1 cut(s)	409
Bst4CI	ACNGT	4 cut(s)	61, 290, 338, 607
BstC8I	GCNNGC	2 cut(s)	507, 561
BstDEI	CTNAG	2 cut(s)	126, 305
BstENI	CCTNNNNNAGG	1 cut(s)	375
BstF5I	GGATG	2 cut(s)	58, 484
BstFNI	CGCG	1 cut(s)	502
BstHHI	GCGC	1 cut(s)	320
BstKTI	GATC	1 cut(s)	412
BstMBI	GATC	1 cut(s)	409
BstMCI	CGRYCG	1 cut(s)	568
BstMWI	GCNNNNNNNGC	6 cut(s)	83, 92, 158, 315, 326, 521
BstNSI	RCATGY	3 cut(s)	408, 509, 563
BstSFI	CTRYAG	1 cut(s)	606
BstUI	CGCG	1 cut(s)	502
BstV1I	GCAGC	1 cut(s)	536
BstV2I	GAAGAC	2 cut(s)	274, 289
BtrI	CACGTC	1 cut(s)	274
BtsCI	GGATG	2 cut(s)	58, 484
BveI	ACCTGC	1 cut(s)	300
Cac8I	GCNNGC	2 cut(s)	507, 561
CfoI	GCGC	1 cut(s)	320
Cfr13I	GGNCC	1 cut(s)	312
Csp6I	GTAC	3 cut(s)	339, 348, 421
CviAII	CATG	5 cut(s)	212, 330, 405, 506, 560
CviJI	RGCY	3 cut(s)	37, 77, 152
CviKI_1	RGCY	3 cut(s)	37, 77, 152
CviQI	GTAC	3 cut(s)	339, 348, 421
DdeI	CTNAG	2 cut(s)	126, 305
DpnI	GATC	1 cut(s)	411
DpnII	GATC	1 cut(s)	409
DrdI	GACNNNNNNGTC	1 cut(s)	291
DseDI	GACNNNNNNGTC	1 cut(s)	291
Eco47I	GGWCC	1 cut(s)	312
EcoNI	CCTNNNNNAGG	1 cut(s)	375
EcoRI	GAATTC	1 cut(s)	536
FaeI	CATG	5 cut(s)	215, 333, 408, 509, 563
FaiI	YATR	7 cut(s)	89, 213, 331, 406, 507, 561, 572
FatI	CATG	5 cut(s)	211, 329, 404, 505, 559
FbaI	TGATCA	1 cut(s)	409
Fnu4HI	GCNGC	3 cut(s)	9, 503, 525
FokI	GGATG	2 cut(s)	65, 491
Fsp4HI	GCNGC	3 cut(s)	9, 503, 525
FspBI	CTAG	3 cut(s)	14, 323, 512
GlaI	GCGC	1 cut(s)	319
GluI	GCNGC	3 cut(s)	9, 503, 525
HhaI	GCGC	1 cut(s)	320
Hin1II	CATG	5 cut(s)	215, 333, 408, 509, 563
Hin6I	GCGC	1 cut(s)	318
HinP1I	GCGC	1 cut(s)	318
HindIII	AAGCTT	1 cut(s)	35
HinfI	GANTC	7 cut(s)	111, 223, 247, 365, 494, 617, 623
HphI	GGTGA	1 cut(s)	532
Hpy166II	GTNNAC	1 cut(s)	462
Hpy188I	TCNGA	4 cut(s)	129, 364, 598, 622
Hpy188III	TCNNGA	3 cut(s)	137, 296, 533
Hpy8I	GTNNAC	1 cut(s)	462
HpyAV	CCTTC	2 cut(s)	442, 590
HpyCH4III	ACNGT	4 cut(s)	61, 290, 338, 607
HpyCH4IV	ACGT	2 cut(s)	116, 273
HpyCH4V	TGCA	2 cut(s)	11, 186
HpyF10VI	GCNNNNNNNGC	6 cut(s)	83, 92, 158, 315, 326, 521
HpyF3I	CTNAG	2 cut(s)	126, 305
HpySE526I	ACGT	2 cut(s)	116, 273
Hsp92II	CATG	5 cut(s)	215, 333, 408, 509, 563
HspAI	GCGC	1 cut(s)	318
Ksp22I	TGATCA	1 cut(s)	409
Kzo9I	GATC	1 cut(s)	409
LmnI	GCTCC	2 cut(s)	158, 648
LpnPI	CCDG	9 cut(s)	7, 184, 264, 295, 309, 328, 384, 401, 546
Lsp1109I	GCAGC	1 cut(s)	536
LweI	GCATC	1 cut(s)	536
MaeI	CTAG	3 cut(s)	14, 323, 512
MaeII	ACGT	2 cut(s)	116, 273
MaeIII	GTNAC	2 cut(s)	17, 274
MalI	GATC	1 cut(s)	411
MboI	GATC	1 cut(s)	409
MboII	GAAGA	2 cut(s)	279, 294
MhlI	GDGCHC	2 cut(s)	134, 653
MluCI	AATT	2 cut(s)	80, 536
MlyI	GAGTC	1 cut(s)	256
MnlI	CCTC	2 cut(s)	24, 319
MroXI	GAANNNNTTC	1 cut(s)	38
MseI	TTAA	1 cut(s)	375
MslI	CAYNNNNRTG	1 cut(s)	200
MvnI	CGCG	1 cut(s)	502
MwoI	GCNNNNNNNGC	6 cut(s)	83, 92, 158, 315, 326, 521
NdeII	GATC	1 cut(s)	409
NlaIII	CATG	5 cut(s)	215, 333, 408, 509, 563
NmuCI	GTSAC	1 cut(s)	274
NspI	RCATGY	3 cut(s)	408, 509, 563
OliI	CACNNNNGTG	1 cut(s)	200
PaeI	GCATGC	2 cut(s)	509, 563
PciI	ACATGT	1 cut(s)	404
PcsI	WCGNNNNNNNCGW	1 cut(s)	561
PdmI	GAANNNNTTC	1 cut(s)	38
PfeI	GAWTC	6 cut(s)	111, 223, 365, 494, 617, 623
PflFI	GACNNNGTC	2 cut(s)	288, 638
PkrI	GCNGC	3 cut(s)	10, 504, 526
PleI	GAGTC	1 cut(s)	255
PpsI	GAGTC	1 cut(s)	255
PscI	ACATGT	1 cut(s)	404
PspPI	GGNCC	1 cut(s)	312
PsyI	GACNNNGTC	2 cut(s)	288, 638
RsaI	GTAC	3 cut(s)	340, 349, 422
RsaNI	GTAC	3 cut(s)	339, 348, 421
RseI	CAYNNNNRTG	1 cut(s)	200
SaqAI	TTAA	1 cut(s)	375
SatI	GCNGC	3 cut(s)	9, 503, 525
Sau3AI	GATC	1 cut(s)	409
Sau96I	GGNCC	1 cut(s)	312
ScaI	AGTACT	1 cut(s)	422
SchI	GAGTC	1 cut(s)	256
SduI	GDGCHC	2 cut(s)	134, 653
SetI	ASST	8 cut(s)	19, 39, 119, 276, 314, 382, 434, 662
SfaNI	GCATC	1 cut(s)	536
SfcI	CTRYAG	1 cut(s)	606
SinI	GGWCC	1 cut(s)	312
SmiMI	CAYNNNNRTG	1 cut(s)	200
SphI	GCATGC	2 cut(s)	509, 563
Sse9I	AATT	2 cut(s)	80, 536
SsiI	CCGC	3 cut(s)	100, 502, 568
SspMI	CTAG	3 cut(s)	14, 323, 512
TaaI	ACNGT	4 cut(s)	61, 290, 338, 607
TaiI	ACGT	2 cut(s)	119, 276
TaqI	TCGA	1 cut(s)	555
TasI	AATT	2 cut(s)	80, 536
TatI	WGTACW	2 cut(s)	338, 420
TauI	GCSGC	1 cut(s)	505
TfiI	GAWTC	6 cut(s)	111, 223, 365, 494, 617, 623
Tru1I	TTAA	1 cut(s)	375
Tru9I	TTAA	1 cut(s)	375
TseFI	GTSAC	1 cut(s)	274
TseI	GCWGC	2 cut(s)	8, 524
Tsp45I	GTSAC	1 cut(s)	274
TspDTI	ATGAA	4 cut(s)	31, 109, 236, 615
TspGWI	ACGGA	1 cut(s)	668
Tth111I	GACNNNGTC	2 cut(s)	288, 638
VpaK11BI	GGWCC	1 cut(s)	312
XagI	CCTNNNNNAGG	1 cut(s)	375
XapI	RAATTY	1 cut(s)	536
XceI	RCATGY	3 cut(s)	408, 509, 563
XmnI	GAANNNNTTC	1 cut(s)	38
XspI	CTAG	3 cut(s)	14, 323, 512
ZrmI	AGTACT	1 cut(s)	422

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.