Rmu_sc0013296.1_g000001

Nucleolar protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0013296.1
Physical Location & Seq
Forward (+)
1 .. 823
823 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0013296.1_g000001.1.cds

Sequence Viewer

Length: 285 bp
gcaaaagctttggtagagccttttgatattagtgaatacattgaacagcagaaaaaggagaagctagaaaaagaatttgctggacagcgaattacgaaaaagagaaaattgcccaaggtcaaccaaaagtttgcagagaggtttttggagtatgaagaagcagaaaatgaaactaaagatattgatgaaaatgagaccaacaagccatccaagaaaaagaaggcacttgatattaatattcttaaagatgagcgatttaaagcaatgtttgaaaataaggtatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

94

Amino Acids

11.24

Weight (kDa)

8.73

Isoelectric Point (pI)

38.8

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 74
AgsI TTSAA 2 cut(s) 44, 272
AluBI AGCT 2 cut(s) 8, 64
AluI AGCT 2 cut(s) 8, 64
Alw26I GTCTC 1 cut(s) 188
ApoI RAATTY 1 cut(s) 74
AseI ATTAAT 1 cut(s) 234
BccI CCATC 1 cut(s) 214
BcoDI GTCTC 1 cut(s) 188
BfaI CTAG 1 cut(s) 65
BsaI GGTCTC 1 cut(s) 188
BsaJI CCNNGG 1 cut(s) 114
Bse3DI GCAATG 1 cut(s) 270
BseDI CCNNGG 1 cut(s) 114
BseGI GGATG 1 cut(s) 206
BseMI GCAATG 1 cut(s) 270
BsmAI GTCTC 1 cut(s) 188
Bso31I GGTCTC 1 cut(s) 188
BspTNI GGTCTC 1 cut(s) 188
BsrDI GCAATG 1 cut(s) 270
BssECI CCNNGG 1 cut(s) 114
BssT1I CCWWGG 1 cut(s) 114
BstF5I GGATG 1 cut(s) 206
BstMAI GTCTC 1 cut(s) 188
BtsCI GGATG 1 cut(s) 206
CviJI RGCY 4 cut(s) 8, 19, 64, 205
CviKI_1 RGCY 4 cut(s) 8, 19, 64, 205
DraI TTTAAA 1 cut(s) 259
Eco130I CCWWGG 1 cut(s) 114
Eco31I GGTCTC 1 cut(s) 188
EcoT14I CCWWGG 1 cut(s) 114
ErhI CCWWGG 1 cut(s) 114
FaiI YATR 2 cut(s) 153, 283
FokI GGATG 1 cut(s) 193
FspBI CTAG 1 cut(s) 65
HincII GTYRAC 1 cut(s) 121
HindII GTYRAC 1 cut(s) 121
HindIII AAGCTT 1 cut(s) 6
Hpy166II GTNNAC 1 cut(s) 121
Hpy8I GTNNAC 1 cut(s) 121
HpyAV CCTTC 1 cut(s) 214
HpyCH4V TGCA 1 cut(s) 134
LpnPI CCDG 1 cut(s) 66
MaeI CTAG 1 cut(s) 65
MboII GAAGA 1 cut(s) 167
MluCI AATT 3 cut(s) 74, 90, 107
MnlI CCTC 1 cut(s) 132
MseI TTAA 3 cut(s) 234, 243, 258
PshBI ATTAAT 1 cut(s) 234
SaqAI TTAA 3 cut(s) 234, 243, 258
SetI ASST 5 cut(s) 10, 66, 120, 143, 282
SgeI CNNG 6 cut(s) 77, 93, 127, 214, 223, 239
Sse9I AATT 3 cut(s) 74, 90, 107
SspI AATATT 1 cut(s) 238
SspMI CTAG 1 cut(s) 65
StyI CCWWGG 1 cut(s) 114
TasI AATT 3 cut(s) 74, 90, 107
Tru1I TTAA 3 cut(s) 234, 243, 258
Tru9I TTAA 3 cut(s) 234, 243, 258
TspDTI ATGAA 3 cut(s) 168, 183, 201
VspI ATTAAT 1 cut(s) 234
XapI RAATTY 1 cut(s) 74
XspI CTAG 1 cut(s) 65
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.