Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0018107.1

Orthogroup ID

OG0006968

Physical Location & Seq

Genomic Coordinates Forward (+)

12491 .. 12964

Gene Structure 474 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0018107.1_g000004.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 474 bp

atgatgacccctactcgacagggctccttgctcctaggctactgcctaatacttctcgtcgccagctctggctgtggtgatggtggctgtgggaccgatctgagtttggaccggagtgttactgatgcggtttctctggggagaatggatacaagggcgggaatcagtttaccgcctgtggattgcggcggtgatttaactccaatggaggtgatggtagatcggtattatttaccgacgacgttgagttgcttggaatcggatccgattgtgtggtctatcctcgatgatggttatgaagttggtggtcagtgctcgcaaggcttctgtttgtgcggcggcagtttctatagtggcaacggttgtttctatgggggtagcaatttccatggcaacggcaatgtcttccaagagggcggcggcaacggcaaagtagtatgggatgctagggattctcccaaatggacatcttag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

157

Amino Acids

16.46

Weight (kDa)

4.21

Isoelectric Point (pI)

27.31

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006968)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr3g0450521 RchiOBHm_Chr5g0016981 RchiOBHm_Chr5g0017131 RchiOBHm_Chr5g0080491
rosa_laevigata	RLG00000008380 RLG00000009306 RLG00000011699 RLG00000014050 RLG00000031887 RLG00000033397 RLG00000034207
rosa_multiflora	Rmu_sc0009984.1_g000012 Rmu_sc0018107.1_g000004 Rmu_sc0020711.1_g000003 Rmu_ssc0000042.1_g000043
rosa_roxburghii	Rroxscaffold_1G00045480 Rroxscaffold_2G00124780 Rroxscaffold_2G00144500 Rroxscaffold_4G00280800 Rroxscaffold_4G00281990 Rroxscaffold_5G00338410
rosa_rugosa	Rorug01G0207900
rosa_samantha	Rh5BG544600 Rh5CG139000 Rh7CG293400
rosa_wichuraiana	Rw5G039350

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	9 cut(s)	128, 158, 173, 186, 189, 336, 339, 417, 420
AclWI	GGATC	2 cut(s)	257, 270
AluBI	AGCT	1 cut(s)	66
AluI	AGCT	1 cut(s)	66
Alw21I	GWGCWC	1 cut(s)	317
AlwI	GGATC	2 cut(s)	257, 270
AspA2I	CCTAGG	1 cut(s)	34
AspS9I	GGNCC	2 cut(s)	93, 109
AsuHPI	GGTGA	3 cut(s)	89, 203, 223
AvaII	GGWCC	2 cut(s)	93, 109
AvrII	CCTAGG	1 cut(s)	34
BamHI	GGATCC	1 cut(s)	262
BanII	GRGCYC	1 cut(s)	26
BbsI	GAAGAC	1 cut(s)	397
Bbv12I	GWGCWC	1 cut(s)	317
BccI	CCATC	3 cut(s)	74, 208, 284
BceAI	ACGGC	2 cut(s)	412, 442
BciVI	GTATCC	1 cut(s)	142
BfaI	CTAG	2 cut(s)	35, 447
BfmI	CTRYAG	1 cut(s)	349
BfuI	GTATCC	1 cut(s)	142
BisI	GCNGC	5 cut(s)	187, 337, 340, 418, 421
BlnI	CCTAGG	1 cut(s)	34
BlsI	GCNGC	5 cut(s)	188, 338, 341, 419, 422
Bme18I	GGWCC	2 cut(s)	93, 109
BmgT120I	GGNCC	2 cut(s)	93, 109
BmiI	GGNNCC	3 cut(s)	25, 94, 264
BmsI	GCATC	2 cut(s)	115, 433
BpiI	GAAGAC	1 cut(s)	397
BsaJI	CCNNGG	2 cut(s)	34, 388
BsaWI	WCCGGW	1 cut(s)	111
Bse3DI	GCAATG	1 cut(s)	406
BseDI	CCNNGG	2 cut(s)	34, 388
BseGI	GGATG	1 cut(s)	448
BseMI	GCAATG	1 cut(s)	406
BseMII	CTCAG	1 cut(s)	92
BsiHKAI	GWGCWC	1 cut(s)	317
BsiSI	CCGG	1 cut(s)	112
BslFI	GGGAC	1 cut(s)	106
BsmFI	GGGAC	1 cut(s)	106
Bsp1286I	GDGCHC	2 cut(s)	26, 317
Bsp143I	GATC	3 cut(s)	97, 220, 262
Bsp19I	CCATGG	1 cut(s)	388
BspACI	CCGC	9 cut(s)	128, 158, 173, 186, 189, 336, 339, 417, 420
BspCNI	CTCAG	1 cut(s)	93
BspLI	GGNNCC	3 cut(s)	25, 94, 264
BspPI	GGATC	2 cut(s)	257, 270
BsrDI	GCAATG	1 cut(s)	406
BssECI	CCNNGG	2 cut(s)	34, 388
BssMI	GATC	3 cut(s)	97, 220, 262
BssT1I	CCWWGG	2 cut(s)	34, 388
Bst4CI	ACNGT	1 cut(s)	362
BstC8I	GCNNGC	2 cut(s)	64, 317
BstDEI	CTNAG	2 cut(s)	101, 471
BstDSI	CCRYGG	1 cut(s)	388
BstF5I	GGATG	1 cut(s)	448
BstKTI	GATC	3 cut(s)	100, 223, 265
BstMBI	GATC	3 cut(s)	97, 220, 262
BstMWI	GCNNNNNNNGC	2 cut(s)	321, 426
BstSFI	CTRYAG	1 cut(s)	349
BstV2I	GAAGAC	1 cut(s)	397
BstX2I	RGATCY	1 cut(s)	262
BstYI	RGATCY	1 cut(s)	262
BsuI	GTATCC	1 cut(s)	142
BtgI	CCRYGG	1 cut(s)	388
BtsCI	GGATG	1 cut(s)	448
BtsIMutI	CAGTG	1 cut(s)	317
Cac8I	GCNNGC	2 cut(s)	64, 317
Cfr13I	GGNCC	2 cut(s)	93, 109
CviAII	CATG	1 cut(s)	389
CviJI	RGCY	6 cut(s)	24, 39, 66, 72, 87, 324
CviKI_1	RGCY	6 cut(s)	24, 39, 66, 72, 87, 324
DdeI	CTNAG	2 cut(s)	101, 471
DpnI	GATC	3 cut(s)	99, 222, 264
DpnII	GATC	3 cut(s)	97, 220, 262
Eco130I	CCWWGG	2 cut(s)	34, 388
Eco24I	GRGCYC	1 cut(s)	26
Eco47I	GGWCC	2 cut(s)	93, 109
EcoT14I	CCWWGG	2 cut(s)	34, 388
EcoT38I	GRGCYC	1 cut(s)	26
ErhI	CCWWGG	2 cut(s)	34, 388
FaeI	CATG	1 cut(s)	392
FaiI	YATR	5 cut(s)	297, 351, 372, 390, 439
FaqI	GGGAC	1 cut(s)	106
FatI	CATG	1 cut(s)	388
FauI	CCCGC	1 cut(s)	151
Fnu4HI	GCNGC	5 cut(s)	187, 337, 340, 418, 421
FokI	GGATG	1 cut(s)	455
FriOI	GRGCYC	1 cut(s)	26
Fsp4HI	GCNGC	5 cut(s)	187, 337, 340, 418, 421
FspBI	CTAG	2 cut(s)	35, 447
GluI	GCNGC	5 cut(s)	187, 337, 340, 418, 421
HapII	CCGG	1 cut(s)	112
Hin1II	CATG	1 cut(s)	392
HinfI	GANTC	3 cut(s)	162, 257, 452
HpaII	CCGG	1 cut(s)	112
HphI	GGTGA	3 cut(s)	89, 203, 223
Hpy166II	GTNNAC	1 cut(s)	170
Hpy188I	TCNGA	3 cut(s)	102, 262, 267
Hpy8I	GTNNAC	1 cut(s)	170
Hpy99I	CGWCG	3 cut(s)	62, 241, 244
HpyCH4III	ACNGT	1 cut(s)	362
HpyCH4IV	ACGT	1 cut(s)	242
HpyF10VI	GCNNNNNNNGC	2 cut(s)	321, 426
HpyF3I	CTNAG	2 cut(s)	101, 471
HpySE526I	ACGT	1 cut(s)	242
Hsp92II	CATG	1 cut(s)	392
Kzo9I	GATC	3 cut(s)	97, 220, 262
LmnI	GCTCC	2 cut(s)	29, 36
LpnPI	CCDG	6 cut(s)	5, 54, 76, 122, 125, 189
LweI	GCATC	2 cut(s)	115, 433
MaeI	CTAG	2 cut(s)	35, 447
MaeII	ACGT	1 cut(s)	242
MaeIII	GTNAC	1 cut(s)	118
MalI	GATC	3 cut(s)	99, 222, 264
MboI	GATC	3 cut(s)	97, 220, 262
MboII	GAAGA	1 cut(s)	397
MflI	RGATCY	1 cut(s)	262
MhlI	GDGCHC	2 cut(s)	26, 317
MluCI	AATT	1 cut(s)	382
MnlI	CCTC	3 cut(s)	202, 293, 406
MseI	TTAA	1 cut(s)	197
MspI	CCGG	1 cut(s)	112
MwoI	GCNNNNNNNGC	2 cut(s)	321, 426
NcoI	CCATGG	1 cut(s)	388
NdeII	GATC	3 cut(s)	97, 220, 262
NlaIII	CATG	1 cut(s)	392
NlaIV	GGNNCC	3 cut(s)	25, 94, 264
PfeI	GAWTC	3 cut(s)	162, 257, 452
PkrI	GCNGC	5 cut(s)	188, 338, 341, 419, 422
PspN4I	GGNNCC	3 cut(s)	25, 94, 264
PspPI	GGNCC	2 cut(s)	93, 109
PsuI	RGATCY	1 cut(s)	262
SaqAI	TTAA	1 cut(s)	197
SatI	GCNGC	5 cut(s)	187, 337, 340, 418, 421
Sau3AI	GATC	3 cut(s)	97, 220, 262
Sau96I	GGNCC	2 cut(s)	93, 109
SduI	GDGCHC	2 cut(s)	26, 317
SetI	ASST	3 cut(s)	68, 213, 245
SfaNI	GCATC	2 cut(s)	115, 433
SfcI	CTRYAG	1 cut(s)	349
SinI	GGWCC	2 cut(s)	93, 109
Sse9I	AATT	1 cut(s)	382
SsiI	CCGC	9 cut(s)	128, 158, 173, 186, 189, 336, 339, 417, 420
SspMI	CTAG	2 cut(s)	35, 447
StyI	CCWWGG	2 cut(s)	34, 388
TaaI	ACNGT	1 cut(s)	362
TaiI	ACGT	1 cut(s)	245
TaqI	TCGA	2 cut(s)	16, 285
TaqII	GACCGA	1 cut(s)	110
TasI	AATT	1 cut(s)	382
TauI	GCSGC	5 cut(s)	189, 339, 342, 420, 423
TfiI	GAWTC	3 cut(s)	162, 257, 452
Tru1I	TTAA	1 cut(s)	197
Tru9I	TTAA	1 cut(s)	197
TscAI	CASTG	1 cut(s)	317
TspDTI	ATGAA	1 cut(s)	312
TspRI	CASTG	1 cut(s)	317
VpaK11BI	GGWCC	2 cut(s)	93, 109
XmaJI	CCTAGG	1 cut(s)	34
XspI	CTAG	2 cut(s)	35, 447

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.