Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0023098.1

Orthogroup ID

OG0000988

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 1225

Gene Structure 1225 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0023098.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 450 bp

cggcagttctggtttgtaactcctccagcagttgggccagatgtcccttacacatttggtctcataggggatctgggccagagctttgattcaaataagacactcactcattatgaattaaatccacagaaaggacaaacagtattgtttgttggtgacctctcttatgcggataactatcccaatcatgataatcacagatgggattcatggggaagattcgtggagagaagtgttgcttatcaaccttggatatggactgcagggaatcatgaacttgattttgctccagaaattggtgaaaccaaaccatttaagccttacactcaccggtatcatgtcccatataaggcatcagggagtacttcccctctttggtactcaatcaagagagcttcctcacacatcatagtcttatcttcatattctgcatatggtaaggaaacatag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0003993 GO:0005488 GO:0005506 GO:0005575 GO:0005576 GO:0005615 GO:0005618 GO:0005622 GO:0005623 GO:0005737 GO:0005829 GO:0005911 GO:0006793 GO:0006796 GO:0006950 GO:0007154 GO:0008150 GO:0008152 GO:0008199 GO:0008270 GO:0009267 GO:0009505 GO:0009506 GO:0009605 GO:0009987 GO:0009991 GO:0016036 GO:0016311 GO:0016787 GO:0016788 GO:0016791 GO:0030054 GO:0030145 GO:0030312 GO:0031667 GO:0031668 GO:0031669 GO:0033554 GO:0042578 GO:0042594 GO:0043167 GO:0043169 GO:0044237 GO:0044421 GO:0044424 GO:0044444 GO:0044464 GO:0046872 GO:0046914 GO:0050896 GO:0051716 GO:0055044 GO:0071496 GO:0071944

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Metallophos Metallophos_C Pur_ac_phosph_N

Protein Analysis

149

Amino Acids

17.1

Weight (kDa)

6.71

Isoelectric Point (pI)

44.07

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000988)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G16430 AT2G16430
fragaria_vesca	FvH4_2g09890 FvH4_2g09920 FvH4_2g09920 FvH4_2g09920
malus_domestica	MD05G1058900.v1.1 MD05G1059100.v1.1 MD05G1059300.v1.1 MD06G1221800.v1.1 MD10G1067300.v1.1
prunus_persica	Prupe.8G088800_v2.0.a1 Prupe.8G088900_v2.0.a1 Prupe.8G088900_v2.0.a1 Prupe.8G088900_v2.0.a1 Prupe.8G088900_v2.0.a1 Prupe.8G088900_v2.0.a1 Prupe.8G088900_v2.0.a1 Prupe.8G088900_v2.0.a1 Prupe.8G089000_v2.0.a1 Prupe.8G089100_v2.0.a1 Prupe.8G089200_v2.0.a1
pyrus_communis	pycom05g05060 pycom05g05070 pycom10g05330
rosa_chinensis	RchiOBHm_Chr5g0073481 RchiOBHm_Chr6g0266421 RchiOBHm_Chr6g0266561 RchiOBHm_Chr6g0266681
rosa_laevigata	RLG00000014085 RLG00000014091 RLG00000014096
rosa_multiflora	Rmu_sc0003605.1_g000010 Rmu_sc0006413.1_g000013 Rmu_sc0022454.1_g000004 Rmu_sc0023098.1_g000001 Rmu_ssc0000226.1_g000024
rosa_roxburghii	Rroxscaffold_1G00007780 Rroxscaffold_7G00201560 Rroxscaffold_7G00201660
rosa_rugosa	Rorug05G0423800 Rorug06G0025500 Rorug06G0026200
rosa_samantha	Rh5AG481100 Rh5BG501800 Rh5CG525000 Rh5DG514200 Rh6AG146200 Rh6AG146700 Rh6AG147400 Rh6BG146400 Rh6BG147800 Rh6CG142800 Rh6CG143600 Rh6DG131000 Rh6DG132400
rosa_wichuraiana	Rw5G044690 Rw6G012590 Rw6G012600 Rw6G012660 Rw6G012700 Rw6G012810

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	2 cut(s)	32, 296
AciI	CCGC	1 cut(s)	170
AclWI	GGATC	1 cut(s)	78
AfaI	GTAC	2 cut(s)	364, 380
AfiI	CCNNNNNNNGG	5 cut(s)	32, 131, 296, 349, 375
AgeI	ACCGGT	1 cut(s)	330
AgsI	TTSAA	1 cut(s)	93
AluBI	AGCT	2 cut(s)	84, 395
AluI	AGCT	2 cut(s)	84, 395
Alw26I	GTCTC	1 cut(s)	65
AlwI	GGATC	1 cut(s)	78
AoxI	GGCC	2 cut(s)	35, 76
AsiGI	ACCGGT	1 cut(s)	330
AspS9I	GGNCC	2 cut(s)	35, 76
AsuHPI	GGTGA	3 cut(s)	167, 311, 320
BccI	CCATC	1 cut(s)	195
BcoDI	GTCTC	1 cut(s)	65
BfmI	CTRYAG	1 cut(s)	261
BmcAI	AGTACT	1 cut(s)	364
BmgT120I	GGNCC	2 cut(s)	35, 76
BmsI	GCATC	1 cut(s)	362
BpmI	CTGGAG	2 cut(s)	9, 273
BsaBI	GATNNNNATC	1 cut(s)	177
BsaI	GGTCTC	1 cut(s)	65
BsaJI	CCNNGG	1 cut(s)	248
BsaWI	WCCGGW	1 cut(s)	330
Bsc4I	CCNNNNNNNGG	5 cut(s)	32, 131, 296, 349, 375
Bse118I	RCCGGY	1 cut(s)	330
Bse8I	GATNNNNATC	1 cut(s)	177
BseDI	CCNNGG	1 cut(s)	248
BseJI	GATNNNNATC	1 cut(s)	177
BseLI	CCNNNNNNNGG	5 cut(s)	32, 131, 296, 349, 375
BseRI	GAGGAG	1 cut(s)	12
BshFI	GGCC	2 cut(s)	37, 78
BshTI	ACCGGT	1 cut(s)	330
BsiSI	CCGG	1 cut(s)	331
BslFI	GGGAC	2 cut(s)	29, 326
BslI	CCNNNNNNNGG	5 cut(s)	32, 131, 296, 349, 375
BsmAI	GTCTC	1 cut(s)	65
BsmFI	GGGAC	2 cut(s)	29, 326
BsnI	GGCC	2 cut(s)	37, 78
Bso31I	GGTCTC	1 cut(s)	65
Bsp143I	GATC	1 cut(s)	70
BspACI	CCGC	1 cut(s)	170
BspANI	GGCC	2 cut(s)	37, 78
BspHI	TCATGA	2 cut(s)	187, 271
BspMAI	CTGCAG	1 cut(s)	265
BspPI	GGATC	1 cut(s)	78
BspTNI	GGTCTC	1 cut(s)	65
BsrFI	RCCGGY	1 cut(s)	330
BssAI	RCCGGY	1 cut(s)	330
BssECI	CCNNGG	1 cut(s)	248
BssMI	GATC	1 cut(s)	70
BssT1I	CCWWGG	1 cut(s)	248
Bst4CI	ACNGT	1 cut(s)	142
BstEII	GGTNACC	1 cut(s)	155
BstKTI	GATC	1 cut(s)	73
BstMAI	GTCTC	1 cut(s)	65
BstMBI	GATC	1 cut(s)	70
BstPI	GGTNACC	1 cut(s)	155
BstSFI	CTRYAG	1 cut(s)	261
BstX2I	RGATCY	1 cut(s)	70
BstYI	RGATCY	1 cut(s)	70
BsuRI	GGCC	2 cut(s)	37, 78
CciI	TCATGA	2 cut(s)	187, 271
Cfr10I	RCCGGY	1 cut(s)	330
Cfr13I	GGNCC	2 cut(s)	35, 76
Csp6I	GTAC	2 cut(s)	363, 379
CspAI	ACCGGT	1 cut(s)	330
CviAII	CATG	4 cut(s)	188, 210, 272, 338
CviJI	RGCY	5 cut(s)	37, 78, 84, 319, 395
CviKI_1	RGCY	5 cut(s)	37, 78, 84, 319, 395
CviQI	GTAC	2 cut(s)	363, 379
DpnI	GATC	1 cut(s)	72
DpnII	GATC	1 cut(s)	70
Eco130I	CCWWGG	1 cut(s)	248
Eco31I	GGTCTC	1 cut(s)	65
Eco91I	GGTNACC	1 cut(s)	155
EcoO65I	GGTNACC	1 cut(s)	155
EcoT14I	CCWWGG	1 cut(s)	248
ErhI	CCWWGG	1 cut(s)	248
FaeI	CATG	4 cut(s)	191, 213, 275, 341
FalI	AAGNNNNNCTT	2 cut(s)	223, 255
FaqI	GGGAC	2 cut(s)	29, 326
FatI	CATG	4 cut(s)	187, 209, 271, 337
FauNDI	CATATG	1 cut(s)	433
GsuI	CTGGAG	2 cut(s)	9, 273
HaeIII	GGCC	2 cut(s)	37, 78
HapII	CCGG	1 cut(s)	331
Hin1II	CATG	4 cut(s)	191, 213, 275, 341
HinfI	GANTC	4 cut(s)	89, 206, 219, 268
HpaII	CCGG	1 cut(s)	331
HphI	GGTGA	3 cut(s)	167, 311, 320
Hpy188III	TCNNGA	4 cut(s)	188, 272, 290, 388
HpyCH4III	ACNGT	1 cut(s)	142
HpyCH4V	TGCA	2 cut(s)	263, 431
Hsp92II	CATG	4 cut(s)	191, 213, 275, 341
Kzo9I	GATC	1 cut(s)	70
LmnI	GCTCC	1 cut(s)	292
LpnPI	CCDG	8 cut(s)	39, 51, 59, 92, 249, 303, 342, 344
LweI	GCATC	1 cut(s)	362
MaeIII	GTNAC	2 cut(s)	16, 155
MalI	GATC	1 cut(s)	72
MboI	GATC	1 cut(s)	70
MboII	GAAGA	2 cut(s)	228, 411
MflI	RGATCY	1 cut(s)	70
MluCI	AATT	2 cut(s)	116, 294
MnlI	CCTC	4 cut(s)	33, 170, 381, 409
MseI	TTAA	2 cut(s)	119, 315
MspI	CCGG	1 cut(s)	331
NdeI	CATATG	1 cut(s)	433
NdeII	GATC	1 cut(s)	70
NlaIII	CATG	4 cut(s)	191, 213, 275, 341
NmuCI	GTSAC	1 cut(s)	155
PagI	TCATGA	2 cut(s)	187, 271
PfeI	GAWTC	4 cut(s)	89, 206, 219, 268
PflMI	CCANNNNNTGG	2 cut(s)	32, 296
PinAI	ACCGGT	1 cut(s)	330
PspEI	GGTNACC	1 cut(s)	155
PspPI	GGNCC	2 cut(s)	35, 76
PstI	CTGCAG	1 cut(s)	265
PsuI	RGATCY	1 cut(s)	70
RsaI	GTAC	2 cut(s)	364, 380
RsaNI	GTAC	2 cut(s)	363, 379
SaqAI	TTAA	2 cut(s)	119, 315
Sau3AI	GATC	1 cut(s)	70
Sau96I	GGNCC	2 cut(s)	35, 76
ScaI	AGTACT	1 cut(s)	364
SetI	ASST	4 cut(s)	86, 162, 250, 397
SfaNI	GCATC	1 cut(s)	362
SfcI	CTRYAG	1 cut(s)	261
Sse9I	AATT	2 cut(s)	116, 294
SsiI	CCGC	1 cut(s)	170
StyI	CCWWGG	1 cut(s)	248
TaaI	ACNGT	1 cut(s)	142
TasI	AATT	2 cut(s)	116, 294
TatI	WGTACW	1 cut(s)	362
TfiI	GAWTC	4 cut(s)	89, 206, 219, 268
Tru1I	TTAA	2 cut(s)	119, 315
Tru9I	TTAA	2 cut(s)	119, 315
TseFI	GTSAC	1 cut(s)	155
Tsp45I	GTSAC	1 cut(s)	155
TspDTI	ATGAA	4 cut(s)	129, 198, 288, 411
Van91I	CCANNNNNTGG	2 cut(s)	32, 296
ZrmI	AGTACT	1 cut(s)	364

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.