Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0029526.1

Orthogroup ID

OG0003809

Physical Location & Seq

Genomic Coordinates Forward (+)

1892 .. 3404

Gene Structure 1513 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0029526.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 384 bp

atgggaacattgacatcaaccatttctgctgctgtcacagttcaaaggatttggactgcagtgccagcatggcaaacagaagaaatatggattcatcatgtgatagttcaatatccaagtcttgttgcatttctgtgtgttgacattattattatgatttctactacgactctgacaacggcacaagcatctcagatagctcgaaatatcacaactaatgaactggcaaatgctattcgttatgggtatcttcgtggtccagatgggcagtttcgaaacccatataatcatgggtgccgtaagaactgtgcagattttttcattcagggctatacagacgatgatgaaattgcctggcctccattgcagcaggttgccagttaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005794 GO:0012505 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044444 GO:0044464

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Ank Ank_2 Ank_3 Ank_4 DHHC

Protein Analysis

127

Amino Acids

14.22

Weight (kDa)

5.41

Isoelectric Point (pI)

22.57

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003809)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G14255
fragaria_vesca	FvH4_2g10900 FvH4_2g10900 FvH4_2g10900 FvH4_2g10900 FvH4_2g10900 FvH4_2g10900 FvH4_2g10900
malus_domestica	MD05G1051300.v1.1 MD10G1058600.v1.1
prunus_persica	Prupe.8G078000_v2.0.a1
pyrus_communis	pycom05g04330 pycom10g04530
rosa_chinensis	RchiOBHm_Chr5g0056731 RchiOBHm_Chr6g0269021
rosa_laevigata	RLG00000013888 RLG00000035124
rosa_multiflora	Rmu_co8178534.1_g000001 Rmu_sc0004350.1_g000008 Rmu_sc0029526.1_g000001 Rmu_sc0033095.1_g000001
rosa_roxburghii	Rroxscaffold_2G00089650 Rroxscaffold_7G00199080
rosa_rugosa	Rorug06G0044700
rosa_samantha	Rh5AG371900 Rh5AG372000 Rh5BG383800 Rh5DG396800 Rh6AG164900 Rh6BG170100 Rh6CG163600 Rh6DG155400
rosa_wichuraiana	Rw5G034890 Rw6G014190

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	361
AccB1I	GGYRCC	1 cut(s)	294
AgsI	TTSAA	2 cut(s)	44, 110
AjnI	CCWGG	1 cut(s)	353
AluBI	AGCT	1 cut(s)	200
AluI	AGCT	1 cut(s)	200
AoxI	GGCC	1 cut(s)	356
ApeKI	GCWGC	2 cut(s)	29, 367
AspS9I	GGNCC	1 cut(s)	257
AsuII	TTCGAA	1 cut(s)	274
AvaII	GGWCC	1 cut(s)	257
BanI	GGYRCC	1 cut(s)	294
BbvI	GCAGC	2 cut(s)	16, 379
BccI	CCATC	1 cut(s)	257
BceAI	ACGGC	2 cut(s)	195, 282
BciT130I	CCWGG	1 cut(s)	355
BfmI	CTRYAG	1 cut(s)	57
BfuAI	ACCTGC	1 cut(s)	361
BglI	GCCNNNNNGGC	1 cut(s)	70
BisI	GCNGC	2 cut(s)	30, 368
BlsI	GCNGC	2 cut(s)	31, 369
Bme1390I	CCNGG	1 cut(s)	355
Bme18I	GGWCC	1 cut(s)	257
BmgT120I	GGNCC	1 cut(s)	257
BmiI	GGNNCC	1 cut(s)	296
BmrFI	CCNGG	1 cut(s)	355
BmsI	GCATC	1 cut(s)	197
Bpu14I	TTCGAA	1 cut(s)	274
Bse1I	ACTGG	2 cut(s)	228, 378
Bse3DI	GCAATG	1 cut(s)	362
BseBI	CCWGG	1 cut(s)	355
BseMI	GCAATG	1 cut(s)	362
BseMII	CTCAG	1 cut(s)	206
BseNI	ACTGG	2 cut(s)	228, 378
BseXI	GCAGC	2 cut(s)	16, 379
BsgI	GTGCAG	1 cut(s)	330
BshFI	GGCC	1 cut(s)	358
BshNI	GGYRCC	1 cut(s)	294
BsnI	GGCC	1 cut(s)	358
Bsp119I	TTCGAA	1 cut(s)	274
BspANI	GGCC	1 cut(s)	358
BspCNI	CTCAG	1 cut(s)	205
BspLI	GGNNCC	1 cut(s)	296
BspMAI	CTGCAG	1 cut(s)	61
BspMI	ACCTGC	1 cut(s)	361
BspT104I	TTCGAA	1 cut(s)	274
BspT107I	GGYRCC	1 cut(s)	294
BsrDI	GCAATG	1 cut(s)	362
BsrI	ACTGG	2 cut(s)	228, 378
Bst2UI	CCWGG	1 cut(s)	355
Bst4CI	ACNGT	2 cut(s)	40, 308
BstBI	TTCGAA	1 cut(s)	274
BstC8I	GCNNGC	1 cut(s)	66
BstDEI	CTNAG	1 cut(s)	192
BstMWI	GCNNNNNNNGC	3 cut(s)	65, 70, 364
BstNI	CCWGG	1 cut(s)	355
BstSCI	CCNGG	1 cut(s)	353
BstSFI	CTRYAG	1 cut(s)	57
BstV1I	GCAGC	2 cut(s)	16, 379
BsuRI	GGCC	1 cut(s)	358
BtsI	GCAGTG	1 cut(s)	66
BtsIMutI	CAGTG	1 cut(s)	66
BveI	ACCTGC	1 cut(s)	361
Cac8I	GCNNGC	1 cut(s)	66
Cfr13I	GGNCC	1 cut(s)	257
CviAII	CATG	3 cut(s)	69, 98, 290
CviJI	RGCY	3 cut(s)	200, 330, 358
CviKI_1	RGCY	3 cut(s)	200, 330, 358
DdeI	CTNAG	1 cut(s)	192
Eco47I	GGWCC	1 cut(s)	257
EcoRII	CCWGG	1 cut(s)	353
FaeI	CATG	3 cut(s)	72, 101, 293
FaiI	YATR	9 cut(s)	70, 88, 99, 155, 243, 283, 285, 291, 333
FatI	CATG	3 cut(s)	68, 97, 289
Fnu4HI	GCNGC	2 cut(s)	30, 368
Fsp4HI	GCNGC	2 cut(s)	30, 368
GluI	GCNGC	2 cut(s)	30, 368
HaeIII	GGCC	1 cut(s)	358
Hin1II	CATG	3 cut(s)	72, 101, 293
HincII	GTYRAC	1 cut(s)	142
HindII	GTYRAC	1 cut(s)	142
HinfI	GANTC	2 cut(s)	91, 169
Hpy166II	GTNNAC	1 cut(s)	142
Hpy188I	TCNGA	2 cut(s)	174, 195
Hpy188III	TCNNGA	1 cut(s)	260
Hpy8I	GTNNAC	1 cut(s)	142
HpyCH4III	ACNGT	2 cut(s)	40, 308
HpyCH4V	TGCA	4 cut(s)	59, 128, 311, 367
HpyF10VI	GCNNNNNNNGC	3 cut(s)	65, 70, 364
HpyF3I	CTNAG	1 cut(s)	192
Hsp92II	CATG	3 cut(s)	72, 101, 293
LpnPI	CCDG	7 cut(s)	78, 209, 273, 311, 340, 356, 367
Lsp1109I	GCAGC	2 cut(s)	16, 379
LweI	GCATC	1 cut(s)	197
MaeIII	GTNAC	1 cut(s)	34
MboII	GAAGA	2 cut(s)	92, 242
MluCI	AATT	1 cut(s)	348
MlyI	GAGTC	1 cut(s)	163
MnlI	CCTC	1 cut(s)	369
MseI	TTAA	1 cut(s)	382
MslI	CAYNNNNRTG	1 cut(s)	133
MspR9I	CCNGG	1 cut(s)	355
MvaI	CCWGG	1 cut(s)	355
MwoI	GCNNNNNNNGC	3 cut(s)	65, 70, 364
NlaIII	CATG	3 cut(s)	72, 101, 293
NlaIV	GGNNCC	1 cut(s)	296
NmuCI	GTSAC	1 cut(s)	34
NspV	TTCGAA	1 cut(s)	274
PfeI	GAWTC	1 cut(s)	91
PkrI	GCNGC	2 cut(s)	31, 369
PleI	GAGTC	1 cut(s)	163
PpsI	GAGTC	1 cut(s)	163
Psp6I	CCWGG	1 cut(s)	353
PspGI	CCWGG	1 cut(s)	353
PspN4I	GGNNCC	1 cut(s)	296
PspPI	GGNCC	1 cut(s)	257
PstI	CTGCAG	1 cut(s)	61
RseI	CAYNNNNRTG	1 cut(s)	133
SaqAI	TTAA	1 cut(s)	382
SatI	GCNGC	2 cut(s)	30, 368
Sau96I	GGNCC	1 cut(s)	257
SchI	GAGTC	1 cut(s)	163
ScrFI	CCNGG	1 cut(s)	355
SetI	ASST	2 cut(s)	202, 375
SfaNI	GCATC	1 cut(s)	197
SfcI	CTRYAG	1 cut(s)	57
SfuI	TTCGAA	1 cut(s)	274
SinI	GGWCC	1 cut(s)	257
SmiMI	CAYNNNNRTG	1 cut(s)	133
Sse9I	AATT	1 cut(s)	348
StyD4I	CCNGG	1 cut(s)	353
TaaI	ACNGT	2 cut(s)	40, 308
TaqI	TCGA	2 cut(s)	202, 274
TasI	AATT	1 cut(s)	348
TfiI	GAWTC	1 cut(s)	91
Tru1I	TTAA	1 cut(s)	382
Tru9I	TTAA	1 cut(s)	382
TscAI	CASTG	1 cut(s)	66
TseFI	GTSAC	1 cut(s)	34
TseI	GCWGC	2 cut(s)	29, 367
Tsp45I	GTSAC	1 cut(s)	34
TspDTI	ATGAA	4 cut(s)	83, 234, 310, 360
TspRI	CASTG	1 cut(s)	66
VpaK11BI	GGWCC	1 cut(s)	257

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.