Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0033095.1

Orthogroup ID

OG0003809

Physical Location & Seq

Genomic Coordinates Reverse (-)

12161 .. 16680

Gene Structure 4520 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0033095.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 633 bp

atgttacctgcagttagctttgggacaatcacagcagttcacgttgctgctcagtatgggcaaacatctttcttgaaccacatcgttgcaaagtatcatgctgattttgatgcacctgataatgagggcaggagtcctcttcattgggctgcatataagggatttgcagatacagttaggttgcttctgtttagagatgcaagccaagggaggcaagataaagaaggttgtacccctttgcactgggctgctttaaaaggaaatgtggaggcttgcactgtgcttgttcatgcaggcacaaagcaggaattaatggtgaaagacaatgctggtttcacacctgttcagattgcatctgataaaggtcatcagcgtgtcgctcttttcctctctagccagcagcgggctcaaggaaaccactggttaaagagaatttgtggtgggaagattgcacattttggttttgctcctatcttgttgtgcacaataatcagtcaaacagttctctttatgaactcagttctcgcagctcctaatctgacaaaggttactgctgctgttggtttctggggatgggcagctatttcatttgcagtgggttcgctcattatgttgtacaggtgcagtaggtaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005794 GO:0012505 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044444 GO:0044464

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Ank Ank_2 Ank_3 Ank_4 DHHC

Protein Analysis

210

Amino Acids

22.85

Weight (kDa)

9.35

Isoelectric Point (pI)

28.09

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003809)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G14255
fragaria_vesca	FvH4_2g10900 FvH4_2g10900 FvH4_2g10900 FvH4_2g10900 FvH4_2g10900 FvH4_2g10900 FvH4_2g10900
malus_domestica	MD05G1051300.v1.1 MD10G1058600.v1.1
prunus_persica	Prupe.8G078000_v2.0.a1
pyrus_communis	pycom05g04330 pycom10g04530
rosa_chinensis	RchiOBHm_Chr5g0056731 RchiOBHm_Chr6g0269021
rosa_laevigata	RLG00000013888 RLG00000035124
rosa_multiflora	Rmu_co8178534.1_g000001 Rmu_sc0004350.1_g000008 Rmu_sc0029526.1_g000001 Rmu_sc0033095.1_g000001
rosa_roxburghii	Rroxscaffold_2G00089650 Rroxscaffold_7G00199080
rosa_rugosa	Rorug06G0044700
rosa_samantha	Rh5AG371900 Rh5AG372000 Rh5BG383800 Rh5DG396800 Rh6AG164900 Rh6BG170100 Rh6CG163600 Rh6DG155400
rosa_wichuraiana	Rw5G034890 Rw6G014190

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	16
AciI	CCGC	1 cut(s)	403
AcsI	RAATTY	1 cut(s)	432
AfaI	GTAC	2 cut(s)	232, 617
AfiI	CCNNNNNNNGG	1 cut(s)	403
AgsI	TTSAA	1 cut(s)	76
AluBI	AGCT	3 cut(s)	18, 530, 581
AluI	AGCT	3 cut(s)	18, 530, 581
Alw21I	GWGCWC	1 cut(s)	485
Alw44I	GTGCAC	1 cut(s)	481
ApaLI	GTGCAC	1 cut(s)	481
ApeKI	GCWGC	7 cut(s)	47, 149, 248, 400, 527, 554, 578
ApoI	RAATTY	1 cut(s)	432
AseI	ATTAAT	1 cut(s)	311
AsuHPI	GGTGA	1 cut(s)	328
BaeGI	GKGCMC	1 cut(s)	485
BanII	GRGCYC	1 cut(s)	409
Bbv12I	GWGCWC	1 cut(s)	485
BbvI	GCAGC	7 cut(s)	34, 136, 235, 412, 539, 541, 590
BccI	CCATC	1 cut(s)	567
BcgI	CGANNNNNNTGC	2 cut(s)	582, 616
BfaI	CTAG	1 cut(s)	393
BfmI	CTRYAG	1 cut(s)	9
BfuAI	ACCTGC	1 cut(s)	16
BisI	GCNGC	7 cut(s)	48, 150, 249, 401, 528, 555, 579
BlsI	GCNGC	7 cut(s)	49, 151, 250, 402, 529, 556, 580
BmrI	ACTGGG	1 cut(s)	253
BmsI	GCATC	3 cut(s)	100, 187, 362
BmuI	ACTGGG	1 cut(s)	253
BpuEI	CTTGAG	1 cut(s)	393
BsaJI	CCNNGG	1 cut(s)	205
Bsc4I	CCNNNNNNNGG	1 cut(s)	403
Bse1I	ACTGG	2 cut(s)	248, 425
BseDI	CCNNGG	1 cut(s)	205
BseGI	GGATG	1 cut(s)	578
BseLI	CCNNNNNNNGG	1 cut(s)	403
BseMII	CTCAG	2 cut(s)	65, 531
BseNI	ACTGG	2 cut(s)	248, 425
BseSI	GKGCMC	1 cut(s)	485
BseXI	GCAGC	7 cut(s)	34, 136, 235, 412, 539, 541, 590
BsiHKAI	GWGCWC	1 cut(s)	485
BslFI	GGGAC	1 cut(s)	37
BslI	CCNNNNNNNGG	1 cut(s)	403
BsmFI	GGGAC	1 cut(s)	37
Bsp1286I	GDGCHC	2 cut(s)	409, 485
Bsp1407I	TGTACA	1 cut(s)	615
BspACI	CCGC	1 cut(s)	403
BspCNI	CTCAG	2 cut(s)	64, 530
BspMAI	CTGCAG	1 cut(s)	13
BspMI	ACCTGC	1 cut(s)	16
BsrGI	TGTACA	1 cut(s)	615
BsrI	ACTGG	2 cut(s)	248, 425
BssECI	CCNNGG	1 cut(s)	205
BssT1I	CCWWGG	1 cut(s)	205
Bst4CI	ACNGT	3 cut(s)	175, 280, 502
Bst6I	CTCTTC	1 cut(s)	144
BstAUI	TGTACA	1 cut(s)	615
BstC8I	GCNNGC	5 cut(s)	202, 274, 295, 398, 405
BstDEI	CTNAG	2 cut(s)	51, 517
BstF5I	GGATG	1 cut(s)	578
BstSFI	CTRYAG	1 cut(s)	9
BstSLI	GKGCMC	1 cut(s)	485
BstV1I	GCAGC	7 cut(s)	34, 136, 235, 412, 539, 541, 590
BtsCI	GGATG	1 cut(s)	578
BtsI	GCAGTG	1 cut(s)	600
BtsIMutI	CAGTG	4 cut(s)	241, 276, 418, 600
BveI	ACCTGC	1 cut(s)	16
Cac8I	GCNNGC	5 cut(s)	202, 274, 295, 398, 405
Csp6I	GTAC	2 cut(s)	231, 616
CviAII	CATG	2 cut(s)	98, 290
CviJI	RGCY	9 cut(s)	18, 149, 204, 248, 272, 396, 407, 530, 581
CviKI_1	RGCY	9 cut(s)	18, 149, 204, 248, 272, 396, 407, 530, 581
CviQI	GTAC	2 cut(s)	231, 616
DdeI	CTNAG	2 cut(s)	51, 517
DraI	TTTAAA	1 cut(s)	255
Eam1104I	CTCTTC	1 cut(s)	144
EarI	CTCTTC	1 cut(s)	144
Eco130I	CCWWGG	1 cut(s)	205
Eco24I	GRGCYC	1 cut(s)	409
EcoT14I	CCWWGG	1 cut(s)	205
EcoT38I	GRGCYC	1 cut(s)	409
ErhI	CCWWGG	1 cut(s)	205
FaeI	CATG	2 cut(s)	101, 293
FaiI	YATR	7 cut(s)	57, 99, 154, 156, 291, 512, 611
FaqI	GGGAC	1 cut(s)	37
FatI	CATG	2 cut(s)	97, 289
FauI	CCCGC	1 cut(s)	396
Fnu4HI	GCNGC	7 cut(s)	48, 150, 249, 401, 528, 555, 579
FokI	GGATG	1 cut(s)	585
FriOI	GRGCYC	1 cut(s)	409
Fsp4HI	GCNGC	7 cut(s)	48, 150, 249, 401, 528, 555, 579
FspBI	CTAG	1 cut(s)	393
GluI	GCNGC	7 cut(s)	48, 150, 249, 401, 528, 555, 579
Hin1II	CATG	2 cut(s)	101, 293
HinfI	GANTC	1 cut(s)	133
HphI	GGTGA	1 cut(s)	328
Hpy166II	GTNNAC	2 cut(s)	40, 483
Hpy188I	TCNGA	3 cut(s)	348, 358, 540
Hpy188III	TCNNGA	1 cut(s)	73
Hpy8I	GTNNAC	2 cut(s)	40, 483
HpyAV	CCTTC	1 cut(s)	218
HpyCH4III	ACNGT	3 cut(s)	175, 280, 502
HpyCH4IV	ACGT	1 cut(s)	42
HpyF3I	CTNAG	2 cut(s)	51, 517
HpySE526I	ACGT	1 cut(s)	42
Hsp92II	CATG	2 cut(s)	101, 293
LmnI	GCTCC	2 cut(s)	472, 535
Lsp1109I	GCAGC	7 cut(s)	34, 136, 235, 412, 539, 541, 590
LweI	GCATC	3 cut(s)	100, 187, 362
MaeI	CTAG	1 cut(s)	393
MaeII	ACGT	1 cut(s)	42
MaeIII	GTNAC	2 cut(s)	3, 547
MboII	GAAGA	2 cut(s)	131, 457
MhlI	GDGCHC	2 cut(s)	409, 485
MluCI	AATT	2 cut(s)	308, 432
MlyI	GAGTC	1 cut(s)	142
MnlI	CCTC	5 cut(s)	118, 147, 204, 262, 398
MseI	TTAA	3 cut(s)	254, 311, 425
MslI	CAYNNNNRTG	1 cut(s)	372
MspA1I	CMGCKG	1 cut(s)	403
NlaIII	CATG	2 cut(s)	101, 293
PkrI	GCNGC	7 cut(s)	49, 151, 250, 402, 529, 556, 580
PleI	GAGTC	1 cut(s)	141
PpsI	GAGTC	1 cut(s)	141
PshBI	ATTAAT	1 cut(s)	311
PstI	CTGCAG	1 cut(s)	13
RsaI	GTAC	2 cut(s)	232, 617
RsaNI	GTAC	2 cut(s)	231, 616
RseI	CAYNNNNRTG	1 cut(s)	372
SaqAI	TTAA	3 cut(s)	254, 311, 425
SatI	GCNGC	7 cut(s)	48, 150, 249, 401, 528, 555, 579
SchI	GAGTC	1 cut(s)	142
SduI	GDGCHC	2 cut(s)	409, 485
SfaNI	GCATC	3 cut(s)	100, 187, 362
SfcI	CTRYAG	1 cut(s)	9
SmiMI	CAYNNNNRTG	1 cut(s)	372
SmlI	CTYRAG	1 cut(s)	408
SmoI	CTYRAG	1 cut(s)	408
Sse9I	AATT	2 cut(s)	308, 432
SsiI	CCGC	1 cut(s)	403
SspMI	CTAG	1 cut(s)	393
StyI	CCWWGG	1 cut(s)	205
TaaI	ACNGT	3 cut(s)	175, 280, 502
TaiI	ACGT	1 cut(s)	45
TasI	AATT	2 cut(s)	308, 432
TatI	WGTACW	1 cut(s)	615
Tru1I	TTAA	3 cut(s)	254, 311, 425
Tru9I	TTAA	3 cut(s)	254, 311, 425
TscAI	CASTG	4 cut(s)	248, 283, 425, 600
TseI	GCWGC	7 cut(s)	47, 149, 248, 400, 527, 554, 578
TspDTI	ATGAA	4 cut(s)	131, 278, 527, 576
TspRI	CASTG	4 cut(s)	248, 283, 425, 600
VneI	GTGCAC	1 cut(s)	481
VspI	ATTAAT	1 cut(s)	311
XapI	RAATTY	1 cut(s)	432
XspI	CTAG	1 cut(s)	393

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.