Rmu_sc0040344.1_g000001

Heavy-metal-associated domain

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0040344.1
Physical Location & Seq
Reverse (-)
1 .. 682
682 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0040344.1_g000001.1.cds

Sequence Viewer

Length: 154 bp
atgggtgaagaaaacaaaccagaggagaagaaggaggaagaaaagaaggaggaagagaagaaggtagaagagccaccggagattgtgctcaaggtcgatatgcattgtgaagcttgcgccaggaaagttgctagagccttgaagggttttgaag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

51

Amino Acids

5.96

Weight (kDa)

5.1

Isoelectric Point (pI)

79.63

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 2 cut(s) 142, 152
AjnI CCWGG 1 cut(s) 119
AluBI AGCT 1 cut(s) 113
AluI AGCT 1 cut(s) 113
Alw21I GWGCWC 1 cut(s) 90
AspLEI GCGC 1 cut(s) 119
AsuHPI GGTGA 1 cut(s) 17
Bbv12I GWGCWC 1 cut(s) 90
BciT130I CCWGG 1 cut(s) 121
BfaI CTAG 1 cut(s) 132
Bme1390I CCNGG 1 cut(s) 121
BmrFI CCNGG 1 cut(s) 121
BpuEI CTTGAG 1 cut(s) 74
BsaWI WCCGGW 1 cut(s) 76
BseBI CCWGG 1 cut(s) 121
BseRI GAGGAG 1 cut(s) 38
BsiHKAI GWGCWC 1 cut(s) 90
BsiSI CCGG 1 cut(s) 77
Bsp1286I GDGCHC 1 cut(s) 90
BspQI GCTCTTC 1 cut(s) 63
Bst2UI CCWGG 1 cut(s) 121
Bst6I CTCTTC 2 cut(s) 48, 63
BstC8I GCNNGC 1 cut(s) 115
BstHHI GCGC 1 cut(s) 119
BstNI CCWGG 1 cut(s) 121
BstSCI CCNGG 1 cut(s) 119
Cac8I GCNNGC 1 cut(s) 115
CfoI GCGC 1 cut(s) 119
CviJI RGCY 3 cut(s) 73, 113, 137
CviKI_1 RGCY 3 cut(s) 73, 113, 137
Eam1104I CTCTTC 2 cut(s) 48, 63
EarI CTCTTC 2 cut(s) 48, 63
EcoRII CCWGG 1 cut(s) 119
EcoT22I ATGCAT 1 cut(s) 105
FaiI YATR 1 cut(s) 101
FspBI CTAG 1 cut(s) 132
GlaI GCGC 1 cut(s) 118
HapII CCGG 1 cut(s) 77
HhaI GCGC 1 cut(s) 119
Hin6I GCGC 1 cut(s) 117
HinP1I GCGC 1 cut(s) 117
HindIII AAGCTT 1 cut(s) 111
HpaII CCGG 1 cut(s) 77
HphI GGTGA 1 cut(s) 17
HpyAV CCTTC 4 cut(s) 25, 40, 55, 136
HpyCH4V TGCA 1 cut(s) 103
HspAI GCGC 1 cut(s) 117
LguI GCTCTTC 1 cut(s) 63
LpnPI CCDG 4 cut(s) 33, 90, 106, 133
MaeI CTAG 1 cut(s) 132
MboII GAAGA 6 cut(s) 20, 40, 50, 65, 70, 80
MhlI GDGCHC 1 cut(s) 90
MnlI CCTC 3 cut(s) 16, 28, 43
Mph1103I ATGCAT 1 cut(s) 105
MspI CCGG 1 cut(s) 77
MspR9I CCNGG 1 cut(s) 121
MvaI CCWGG 1 cut(s) 121
NsiI ATGCAT 1 cut(s) 105
PciSI GCTCTTC 1 cut(s) 63
Psp6I CCWGG 1 cut(s) 119
PspGI CCWGG 1 cut(s) 119
SapI GCTCTTC 1 cut(s) 63
ScrFI CCNGG 1 cut(s) 121
SduI GDGCHC 1 cut(s) 90
SetI ASST 3 cut(s) 66, 96, 115
SgeI CNNG 7 cut(s) 32, 89, 103, 126, 132, 133, 144
SmlI CTYRAG 1 cut(s) 89
SmoI CTYRAG 1 cut(s) 89
SspMI CTAG 1 cut(s) 132
StyD4I CCNGG 1 cut(s) 119
TaqI TCGA 1 cut(s) 96
XspI CTAG 1 cut(s) 132
Zsp2I ATGCAT 1 cut(s) 105
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.