Rmu_ssc0000041.1_g000003

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000041.1
Physical Location & Seq
Forward (+)
7767 .. 8075
309 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000041.1_g000003.1.cds

Sequence Viewer

Length: 309 bp
atgccatccgctagtacaacaattgaagtagaaaagattaagctcgtactttgggagaagaatttgcagcggttgctcgttgataaatcaggctatgaagatggaaaagctgatctagagtttgttacttctttttcagacgaactagcacaagggttgttggcacagggaacagctgctgcagcagcagattcttttagcaagattatccagatgggattcatgttcgattttaatgagagtaaagtggagtttctgctgatgagagaaaatttagagttaatggaggaggatatgagtttctgctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

102

Amino Acids

11.48

Weight (kDa)

4.27

Isoelectric Point (pI)

28.51

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 9, 70
AcsI RAATTY 2 cut(s) 61, 271
AfaI GTAC 2 cut(s) 16, 48
AgsI TTSAA 1 cut(s) 26
AluBI AGCT 3 cut(s) 43, 110, 176
AluI AGCT 3 cut(s) 43, 110, 176
AlwNI CAGNNNCTG 1 cut(s) 179
ApeKI GCWGC 5 cut(s) 67, 176, 179, 182, 185
ApoI RAATTY 2 cut(s) 61, 271
BbvI GCAGC 5 cut(s) 79, 163, 166, 194, 197
BccI CCATC 3 cut(s) 13, 95, 208
BfaI CTAG 3 cut(s) 12, 116, 146
BfmI CTRYAG 1 cut(s) 180
BisI GCNGC 5 cut(s) 68, 177, 180, 183, 186
BlsI GCNGC 5 cut(s) 69, 178, 181, 184, 187
BseGI GGATG 1 cut(s) 5
BseRI GAGGAG 1 cut(s) 302
BseXI GCAGC 5 cut(s) 79, 163, 166, 194, 197
Bsp143I GATC 1 cut(s) 112
BspACI CCGC 2 cut(s) 9, 70
BspMAI CTGCAG 1 cut(s) 184
BssMI GATC 1 cut(s) 112
BstAPI GCANNNNNTGC 1 cut(s) 73
BstF5I GGATG 1 cut(s) 5
BstKTI GATC 1 cut(s) 115
BstMBI GATC 1 cut(s) 112
BstMWI GCNNNNNNNGC 3 cut(s) 73, 182, 185
BstSFI CTRYAG 1 cut(s) 180
BstV1I GCAGC 5 cut(s) 79, 163, 166, 194, 197
BtsCI GGATG 1 cut(s) 5
CaiI CAGNNNCTG 1 cut(s) 179
Csp6I GTAC 2 cut(s) 15, 47
CviAII CATG 1 cut(s) 223
CviJI RGCY 4 cut(s) 43, 93, 110, 176
CviKI_1 RGCY 4 cut(s) 43, 93, 110, 176
CviQI GTAC 2 cut(s) 15, 47
DpnI GATC 1 cut(s) 114
DpnII GATC 1 cut(s) 112
FaeI CATG 1 cut(s) 226
FaiI YATR 3 cut(s) 96, 224, 296
FatI CATG 1 cut(s) 222
Fnu4HI GCNGC 5 cut(s) 68, 177, 180, 183, 186
Fsp4HI GCNGC 5 cut(s) 68, 177, 180, 183, 186
FspBI CTAG 3 cut(s) 12, 116, 146
GluI GCNGC 5 cut(s) 68, 177, 180, 183, 186
Hin1II CATG 1 cut(s) 226
HinfI GANTC 2 cut(s) 191, 219
Hpy188I TCNGA 1 cut(s) 139
Hpy188III TCNNGA 2 cut(s) 116, 211
HpyCH4V TGCA 2 cut(s) 67, 182
HpyF10VI GCNNNNNNNGC 3 cut(s) 73, 182, 185
Hsp92II CATG 1 cut(s) 226
Kzo9I GATC 1 cut(s) 112
LpnPI CCDG 3 cut(s) 75, 152, 224
Lsp1109I GCAGC 5 cut(s) 79, 163, 166, 194, 197
MaeI CTAG 3 cut(s) 12, 116, 146
MaeIII GTNAC 1 cut(s) 124
MalI GATC 1 cut(s) 114
MboI GATC 1 cut(s) 112
MboII GAAGA 2 cut(s) 70, 110
MfeI CAATTG 1 cut(s) 21
MluCI AATT 3 cut(s) 21, 61, 271
MnlI CCTC 2 cut(s) 280, 283
MseI TTAA 3 cut(s) 39, 234, 281
MspA1I CMGCKG 2 cut(s) 70, 176
MunI CAATTG 1 cut(s) 21
MwoI GCNNNNNNNGC 3 cut(s) 73, 182, 185
NdeII GATC 1 cut(s) 112
NlaIII CATG 1 cut(s) 226
PfeI GAWTC 2 cut(s) 191, 219
PkrI GCNGC 5 cut(s) 69, 178, 181, 184, 187
PstI CTGCAG 1 cut(s) 184
PstNI CAGNNNCTG 1 cut(s) 179
PvuII CAGCTG 1 cut(s) 176
RsaI GTAC 2 cut(s) 16, 48
RsaNI GTAC 2 cut(s) 15, 47
SaqAI TTAA 3 cut(s) 39, 234, 281
SatI GCNGC 5 cut(s) 68, 177, 180, 183, 186
Sau3AI GATC 1 cut(s) 112
SetI ASST 3 cut(s) 45, 112, 178
SfcI CTRYAG 1 cut(s) 180
Sse9I AATT 3 cut(s) 21, 61, 271
SsiI CCGC 2 cut(s) 9, 70
SspMI CTAG 3 cut(s) 12, 116, 146
TaqI TCGA 1 cut(s) 228
TasI AATT 3 cut(s) 21, 61, 271
TatI WGTACW 1 cut(s) 14
TfiI GAWTC 2 cut(s) 191, 219
Tru1I TTAA 3 cut(s) 39, 234, 281
Tru9I TTAA 3 cut(s) 39, 234, 281
TseI GCWGC 5 cut(s) 67, 176, 179, 182, 185
TspDTI ATGAA 2 cut(s) 111, 211
XapI RAATTY 2 cut(s) 61, 271
XbaI TCTAGA 1 cut(s) 115
XspI CTAG 3 cut(s) 12, 116, 146
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.