Rmu_ssc0000114.1_g000062

BOI-related E3 ubiquitin-protein ligase 2

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000114.1
OG0003008
Physical Location & Seq
Reverse (-)
330623 .. 331521
899 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 819 bp
atgagtggcttttcacagcaacaggattgggctctgatcaaccctcctcatccgctttccgattccgggtttgatcatgacttcttttccggcatcattccaaaccggcctcaaccttatcagcagcaacaagctcctcagtttcatcaaaatctagaagctaaccggttaggagtttcttctgtttctcctaattccacttgcaatagcttccttcccacaacgtcattatttcccgatactttgaccgctcagctcgacttgcaaaggcgggagatagattgcattcttcagttgcagaatgagaagctgagatttgctttgcaagagcagaggaagcgacagctggcggctctgttgagcaacttcgagtcgaggacgtcaagtttgatgaggcaaaaagaggagcacttatcacaagcgagaaagagagcaatggagcttcaagattgcttgagaaaagcggagatggagaccgagacgtggcagagattggccaaagcaaacgagacgacggtgatggacctcaacaacgcgctcgaacaggtcaaagagagaatggtcctgtgcagcaacgaagtcgatgatgcagagtccttctgtggctcgtgtgagaagcagcagcagcaagtgctttcagaaaaagtaactcacaaaacgttgggtttggattgtaaaagctgtaatgctagaaggtcgtgcgtgctttttcttccttgcagacacctctgttcgtgcaagttttgtgaagcttttcttgattgctgccccgtgtgtaaatccaccaaggaggcaagcatggaggtctttttggtctaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
zf-C3HC4_3

Protein Analysis

272

Amino Acids

31.06

Weight (kDa)

6.11

Isoelectric Point (pI)

58.41

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
zf-C3HC4_3 PF13920 224 - 264 1.9e-07 Zinc finger, C3HC4 type (RING finger)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 383
AccBSI CCGCTC 1 cut(s) 251
AccII CGCG 1 cut(s) 536
AciI CCGC 5 cut(s) 53, 249, 271, 350, 464
AclI AACGTT 1 cut(s) 659
AcoI YGGCCR 1 cut(s) 495
AcuI CTGAAG 1 cut(s) 275
AcyI GRCGYC 1 cut(s) 380
AfiI CCNNNNNNNGG 2 cut(s) 66, 483
AgeI ACCGGT 1 cut(s) 165
AgsI TTSAA 1 cut(s) 446
AjiI CACGTC 1 cut(s) 483
AluBI AGCT 9 cut(s) 134, 161, 210, 256, 310, 346, 442, 681, 752
AluI AGCT 9 cut(s) 134, 161, 210, 256, 310, 346, 442, 681, 752
Alw21I GWGCWC 1 cut(s) 411
Alw26I GTCTC 3 cut(s) 467, 473, 503
AoxI GGCC 2 cut(s) 107, 495
ApeKI GCWGC 6 cut(s) 124, 570, 619, 622, 625, 765
ArsI GACNNNNNNTTYG 2 cut(s) 370, 402
AsiGI ACCGGT 1 cut(s) 165
Asp700I GAANNNNTTC 1 cut(s) 753
AspLEI GCGC 1 cut(s) 538
AspS9I GGNCC 2 cut(s) 523, 562
AsuC2I CCSGG 1 cut(s) 67
AsuHPI GGTGA 1 cut(s) 529
AvaII GGWCC 2 cut(s) 523, 562
BalI TGGCCA 1 cut(s) 497
BanII GRGCYC 1 cut(s) 34
BauI CACGAG 1 cut(s) 607
Bbv12I GWGCWC 1 cut(s) 411
BbvI GCAGC 6 cut(s) 136, 582, 631, 634, 637, 752
BccI CCATC 2 cut(s) 463, 514
BcgI CGANNNNNNTGC 2 cut(s) 562, 596
BclI TGATCA 2 cut(s) 36, 73
BcnI CCSGG 1 cut(s) 67
BcoDI GTCTC 3 cut(s) 467, 473, 503
BfaI CTAG 2 cut(s) 155, 690
BisI GCNGC 7 cut(s) 125, 351, 571, 620, 623, 626, 766
BlpI GCTNAGC 1 cut(s) 252
BlsI GCNGC 7 cut(s) 126, 352, 572, 621, 624, 627, 767
Bme1390I CCNGG 1 cut(s) 67
Bme18I GGWCC 2 cut(s) 523, 562
BmgBI CACGTC 1 cut(s) 483
BmgT120I GGNCC 2 cut(s) 523, 562
BmrFI CCNGG 1 cut(s) 67
BmsI GCATC 2 cut(s) 102, 577
Bpu1102I GCTNAGC 1 cut(s) 252
BpuEI CTTGAG 1 cut(s) 475
BpuMI CCSGG 1 cut(s) 67
BsaHI GRCGYC 1 cut(s) 380
BsaI GGTCTC 1 cut(s) 467
BsaJI CCNNGG 1 cut(s) 786
BsaWI WCCGGW 1 cut(s) 165
Bsc4I CCNNNNNNNGG 2 cut(s) 66, 483
Bse118I RCCGGY 2 cut(s) 105, 165
Bse3DI GCAATG 1 cut(s) 441
BseDI CCNNGG 1 cut(s) 786
BseGI GGATG 1 cut(s) 49
BseLI CCNNNNNNNGG 2 cut(s) 66, 483
BseMI GCAATG 1 cut(s) 441
BseMII CTCAG 3 cut(s) 152, 266, 302
BseRI GAGGAG 3 cut(s) 36, 126, 419
BseXI GCAGC 6 cut(s) 136, 582, 631, 634, 637, 752
BsgI GTGCAG 1 cut(s) 589
Bsh1236I CGCG 1 cut(s) 536
BshFI GGCC 2 cut(s) 109, 497
BshTI ACCGGT 1 cut(s) 165
BsiHKAI GWGCWC 1 cut(s) 411
BsiSI CCGG 4 cut(s) 66, 90, 106, 166
BslI CCNNNNNNNGG 2 cut(s) 66, 483
BsmAI GTCTC 3 cut(s) 467, 473, 503
BsmBI CGTCTC 2 cut(s) 473, 503
BsmI GAATGC 1 cut(s) 285
BsnI GGCC 2 cut(s) 109, 497
Bso31I GGTCTC 1 cut(s) 467
Bsp1286I GDGCHC 2 cut(s) 34, 411
Bsp143I GATC 2 cut(s) 36, 73
Bsp1720I GCTNAGC 1 cut(s) 252
BspACI CCGC 5 cut(s) 53, 249, 271, 350, 464
BspANI GGCC 2 cut(s) 109, 497
BspCNI CTCAG 3 cut(s) 151, 265, 303
BspFNI CGCG 1 cut(s) 536
BspHI TCATGA 1 cut(s) 76
BspTNI GGTCTC 1 cut(s) 467
BsrBI CCGCTC 1 cut(s) 251
BsrDI GCAATG 1 cut(s) 441
BsrFI RCCGGY 2 cut(s) 105, 165
BssAI RCCGGY 2 cut(s) 105, 165
BssECI CCNNGG 1 cut(s) 786
BssMI GATC 2 cut(s) 36, 73
BssNI GRCGYC 1 cut(s) 380
BssSI CACGAG 1 cut(s) 607
BssT1I CCWWGG 1 cut(s) 786
Bst2BI CACGAG 1 cut(s) 607
Bst4CI ACNGT 1 cut(s) 517
BstACI GRCGYC 1 cut(s) 380
BstAPI GCANNNNNTGC 1 cut(s) 631
BstC8I GCNNGC 3 cut(s) 348, 704, 796
BstDEI CTNAG 3 cut(s) 138, 252, 311
BstF5I GGATG 1 cut(s) 49
BstFNI CGCG 1 cut(s) 536
BstHHI GCGC 1 cut(s) 538
BstKTI GATC 2 cut(s) 39, 76
BstMAI GTCTC 3 cut(s) 467, 473, 503
BstMBI GATC 2 cut(s) 36, 73
BstMWI GCNNNNNNNGC 4 cut(s) 262, 337, 625, 631
BstSCI CCNGG 1 cut(s) 65
BstUI CGCG 1 cut(s) 536
BstV1I GCAGC 6 cut(s) 136, 582, 631, 634, 637, 752
BsuRI GGCC 2 cut(s) 109, 497
BtrI CACGTC 1 cut(s) 483
BtsCI GGATG 1 cut(s) 49
Cac8I GCNNGC 3 cut(s) 348, 704, 796
CciI TCATGA 1 cut(s) 76
CfoI GCGC 1 cut(s) 538
Cfr10I RCCGGY 2 cut(s) 105, 165
Cfr13I GGNCC 2 cut(s) 523, 562
CspAI ACCGGT 1 cut(s) 165
CviAII CATG 2 cut(s) 77, 799
DdeI CTNAG 3 cut(s) 138, 252, 311
DpnI GATC 2 cut(s) 38, 75
DpnII GATC 2 cut(s) 36, 73
EaeI YGGCCR 1 cut(s) 495
Eco130I CCWWGG 1 cut(s) 786
Eco24I GRGCYC 1 cut(s) 34
Eco31I GGTCTC 1 cut(s) 467
Eco47I GGWCC 2 cut(s) 523, 562
Eco57I CTGAAG 1 cut(s) 275
EcoT14I CCWWGG 1 cut(s) 786
EcoT38I GRGCYC 1 cut(s) 34
ErhI CCWWGG 1 cut(s) 786
Esp3I CGTCTC 2 cut(s) 473, 503
FaeI CATG 2 cut(s) 80, 802
FaiI YATR 2 cut(s) 78, 800
FalI AAGNNNNNCTT 2 cut(s) 741, 773
FatI CATG 2 cut(s) 76, 798
FauI CCCGC 1 cut(s) 264
FbaI TGATCA 2 cut(s) 36, 73
Fnu4HI GCNGC 7 cut(s) 125, 351, 571, 620, 623, 626, 766
FokI GGATG 1 cut(s) 36
FriOI GRGCYC 1 cut(s) 34
Fsp4HI GCNGC 7 cut(s) 125, 351, 571, 620, 623, 626, 766
FspBI CTAG 2 cut(s) 155, 690
GlaI GCGC 1 cut(s) 537
GluI GCNGC 7 cut(s) 125, 351, 571, 620, 623, 626, 766
HaeIII GGCC 2 cut(s) 109, 497
HapII CCGG 4 cut(s) 66, 90, 106, 166
HhaI GCGC 1 cut(s) 538
Hin1I GRCGYC 1 cut(s) 380
Hin1II CATG 2 cut(s) 80, 802
Hin6I GCGC 1 cut(s) 536
HinP1I GCGC 1 cut(s) 536
HindIII AAGCTT 1 cut(s) 750
HinfI GANTC 3 cut(s) 62, 371, 593
HpaII CCGG 4 cut(s) 66, 90, 106, 166
HphI GGTGA 1 cut(s) 529
Hpy188I TCNGA 3 cut(s) 36, 61, 640
Hpy188III TCNNGA 5 cut(s) 77, 155, 236, 446, 758
Hpy99I CGWCG 1 cut(s) 517
HpyAV CCTTC 3 cut(s) 224, 607, 687
HpyCH4III ACNGT 1 cut(s) 517
HpyCH4IV ACGT 4 cut(s) 224, 380, 482, 659
HpyCH4V TGCA 9 cut(s) 204, 265, 285, 298, 325, 570, 590, 720, 738
HpyF10VI GCNNNNNNNGC 4 cut(s) 262, 337, 625, 631
HpyF3I CTNAG 3 cut(s) 138, 252, 311
HpySE526I ACGT 4 cut(s) 224, 380, 482, 659
Hsp92I GRCGYC 1 cut(s) 380
Hsp92II CATG 2 cut(s) 80, 802
HspAI GCGC 1 cut(s) 536
Ksp22I TGATCA 2 cut(s) 36, 73
Kzo9I GATC 2 cut(s) 36, 73
LmnI GCTCC 3 cut(s) 139, 406, 439
LpnPI CCDG 8 cut(s) 8, 79, 103, 119, 179, 332, 530, 578
Lsp1109I GCAGC 6 cut(s) 136, 582, 631, 634, 637, 752
LweI GCATC 2 cut(s) 102, 577
MaeI CTAG 2 cut(s) 155, 690
MaeII ACGT 4 cut(s) 224, 380, 482, 659
MaeIII GTNAC 1 cut(s) 646
MalI GATC 2 cut(s) 38, 75
MbiI CCGCTC 1 cut(s) 251
MboI GATC 2 cut(s) 36, 73
MboII GAAGA 3 cut(s) 171, 281, 704
MhlI GDGCHC 2 cut(s) 34, 411
MlsI TGGCCA 1 cut(s) 497
MluCI AATT 1 cut(s) 193
MluNI TGGCCA 1 cut(s) 497
MlyI GAGTC 2 cut(s) 380, 602
Mox20I TGGCCA 1 cut(s) 497
MroXI GAANNNNTTC 1 cut(s) 753
MscI TGGCCA 1 cut(s) 497
Msp20I TGGCCA 1 cut(s) 497
MspA1I CMGCKG 1 cut(s) 346
MspI CCGG 4 cut(s) 66, 90, 106, 166
MspR9I CCNGG 1 cut(s) 67
Mva1269I GAATGC 1 cut(s) 285
MvnI CGCG 1 cut(s) 536
MwoI GCNNNNNNNGC 4 cut(s) 262, 337, 625, 631
NciI CCSGG 1 cut(s) 67
NdeII GATC 2 cut(s) 36, 73
NlaIII CATG 2 cut(s) 80, 802
PagI TCATGA 1 cut(s) 76
PctI GAATGC 1 cut(s) 285
PdmI GAANNNNTTC 1 cut(s) 753
PfeI GAWTC 1 cut(s) 62
PinAI ACCGGT 1 cut(s) 165
PkrI GCNGC 7 cut(s) 126, 352, 572, 621, 624, 627, 767
PleI GAGTC 2 cut(s) 379, 601
PpsI GAGTC 2 cut(s) 379, 601
Psp1406I AACGTT 1 cut(s) 659
PspPI GGNCC 2 cut(s) 523, 562
PvuII CAGCTG 1 cut(s) 346
SatI GCNGC 7 cut(s) 125, 351, 571, 620, 623, 626, 766
Sau3AI GATC 2 cut(s) 36, 73
Sau96I GGNCC 2 cut(s) 523, 562
SchI GAGTC 2 cut(s) 380, 602
ScrFI CCNGG 1 cut(s) 67
SduI GDGCHC 2 cut(s) 34, 411
SfaNI GCATC 2 cut(s) 102, 577
SinI GGWCC 2 cut(s) 523, 562
SmlI CTYRAG 1 cut(s) 454
SmoI CTYRAG 1 cut(s) 454
Sse9I AATT 1 cut(s) 193
SsiI CCGC 5 cut(s) 53, 249, 271, 350, 464
SspMI CTAG 2 cut(s) 155, 690
StyD4I CCNGG 1 cut(s) 65
StyI CCWWGG 1 cut(s) 786
TaaI ACNGT 1 cut(s) 517
TaiI ACGT 4 cut(s) 227, 383, 485, 662
TaqI TCGA 5 cut(s) 258, 369, 374, 540, 582
TaqII GACCGA 1 cut(s) 491
TasI AATT 1 cut(s) 193
TauI GCSGC 1 cut(s) 353
TfiI GAWTC 1 cut(s) 62
TseI GCWGC 6 cut(s) 124, 570, 619, 622, 625, 765
TspDTI ATGAA 1 cut(s) 134
VpaK11BI GGWCC 2 cut(s) 523, 562
XbaI TCTAGA 1 cut(s) 154
XmnI GAANNNNTTC 1 cut(s) 753
XspI CTAG 2 cut(s) 155, 690
ZraI GACGTC 1 cut(s) 381
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.