Rroxscaffold_1G00020570

Activator of 90 kDa heat shock protein ATPase homolog

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Forward (+)
24950287 .. 24963211
12925 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00020570.1

Sequence Viewer

Length: 243 bp
ATGGAAGTGCTTTACTCGAGTAATGCTAAGATAAGCAAGGAGGTTGGAAGAGAATTTAACATTTTTGATGGGTCGGTGCTTACTCTTGAGGAGCCTAAACATGGTCTTACCATCATCAAGCTAACGCATGTGGATGTTCCTGAAGAAGATAGCTCCGGGCCTAATGCGCAACTTGGATCAAGCCTTAATCGACCCTATCTTCTCGCTTCTCCGTCCTCTGTGAGATTTGCCCAATTTCTTTAG

Protein Analysis

80

Amino Acids

8.78

Weight (kDa)

5.19

Isoelectric Point (pI)

48.44

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 168
AclWI GGATC 1 cut(s) 184
AcsI RAATTY 1 cut(s) 53
AcuI CTGAAG 1 cut(s) 162
AfiI CCNNNNNNNGG 1 cut(s) 101
AluBI AGCT 2 cut(s) 121, 153
AluI AGCT 2 cut(s) 121, 153
AlwI GGATC 1 cut(s) 184
Ama87I CYCGRG 1 cut(s) 16
AoxI GGCC 1 cut(s) 158
ApoI RAATTY 1 cut(s) 53
AspLEI GCGC 1 cut(s) 169
AspS9I GGNCC 1 cut(s) 158
AsuC2I CCSGG 1 cut(s) 157
AvaI CYCGRG 1 cut(s) 16
BccI CCATC 2 cut(s) 62, 119
BcnI CCSGG 1 cut(s) 157
Bme1390I CCNGG 1 cut(s) 157
BmeT110I CYCGRG 1 cut(s) 16
BmgT120I GGNCC 1 cut(s) 158
BmiI GGNNCC 1 cut(s) 93
BmrFI CCNGG 1 cut(s) 157
BpuEI CTTGAG 1 cut(s) 107
BpuMI CCSGG 1 cut(s) 157
Bsc4I CCNNNNNNNGG 1 cut(s) 101
BseGI GGATG 1 cut(s) 139
BseLI CCNNNNNNNGG 1 cut(s) 101
BseRI GAGGAG 1 cut(s) 104
BshFI GGCC 1 cut(s) 160
BsiHKCI CYCGRG 1 cut(s) 16
BsiSI CCGG 1 cut(s) 156
BslI CCNNNNNNNGG 1 cut(s) 101
BsnI GGCC 1 cut(s) 160
BsoBI CYCGRG 1 cut(s) 16
Bsp143I GATC 1 cut(s) 176
BspANI GGCC 1 cut(s) 160
BspLI GGNNCC 1 cut(s) 93
BspPI GGATC 1 cut(s) 184
BssMI GATC 1 cut(s) 176
Bst6I CTCTTC 1 cut(s) 43
BstDEI CTNAG 1 cut(s) 27
BstF5I GGATG 1 cut(s) 139
BstHHI GCGC 1 cut(s) 169
BstKTI GATC 1 cut(s) 179
BstMBI GATC 1 cut(s) 176
BstMWI GCNNNNNNNGC 1 cut(s) 166
BstNSI RCATGY 1 cut(s) 131
BstSCI CCNGG 1 cut(s) 155
BsuRI GGCC 1 cut(s) 160
BtsCI GGATG 1 cut(s) 139
CfoI GCGC 1 cut(s) 169
Cfr13I GGNCC 1 cut(s) 158
CviAII CATG 2 cut(s) 101, 128
CviJI RGCY 5 cut(s) 94, 121, 153, 160, 183
CviKI_1 RGCY 5 cut(s) 94, 121, 153, 160, 183
DdeI CTNAG 1 cut(s) 27
DpnI GATC 1 cut(s) 178
DpnII GATC 1 cut(s) 176
Eam1104I CTCTTC 1 cut(s) 43
EarI CTCTTC 1 cut(s) 43
Eco57I CTGAAG 1 cut(s) 162
Eco88I CYCGRG 1 cut(s) 16
FaeI CATG 2 cut(s) 104, 131
FaiI YATR 2 cut(s) 102, 129
FatI CATG 2 cut(s) 100, 127
FokI GGATG 1 cut(s) 146
FspI TGCGCA 1 cut(s) 168
GlaI GCGC 1 cut(s) 168
HaeIII GGCC 1 cut(s) 160
HapII CCGG 1 cut(s) 156
HhaI GCGC 1 cut(s) 169
Hin1II CATG 2 cut(s) 104, 131
Hin6I GCGC 1 cut(s) 167
HinP1I GCGC 1 cut(s) 167
HpaII CCGG 1 cut(s) 156
Hpy188III TCNNGA 2 cut(s) 86, 140
HpyF10VI GCNNNNNNNGC 1 cut(s) 166
HpyF3I CTNAG 1 cut(s) 27
Hsp92II CATG 2 cut(s) 104, 131
HspAI GCGC 1 cut(s) 167
Kzo9I GATC 1 cut(s) 176
LmnI GCTCC 2 cut(s) 91, 158
LpnPI CCDG 2 cut(s) 153, 169
MalI GATC 1 cut(s) 178
MboI GATC 1 cut(s) 176
MboII GAAGA 4 cut(s) 60, 155, 158, 191
MluCI AATT 2 cut(s) 53, 233
MmeI TCCRAC 1 cut(s) 25
MnlI CCTC 3 cut(s) 34, 82, 226
MseI TTAA 2 cut(s) 57, 186
MslI CAYNNNNRTG 1 cut(s) 132
MspI CCGG 1 cut(s) 156
MspR9I CCNGG 1 cut(s) 157
MwoI GCNNNNNNNGC 1 cut(s) 166
NciI CCSGG 1 cut(s) 157
NdeII GATC 1 cut(s) 176
NlaIII CATG 2 cut(s) 104, 131
NlaIV GGNNCC 1 cut(s) 93
NsbI TGCGCA 1 cut(s) 168
NspI RCATGY 1 cut(s) 131
PaeR7I CTCGAG 1 cut(s) 16
PspN4I GGNNCC 1 cut(s) 93
PspPI GGNCC 1 cut(s) 158
PspXI VCTCGAGB 1 cut(s) 16
RseI CAYNNNNRTG 1 cut(s) 132
SaqAI TTAA 2 cut(s) 57, 186
Sau3AI GATC 1 cut(s) 176
Sau96I GGNCC 1 cut(s) 158
ScrFI CCNGG 1 cut(s) 157
SetI ASST 3 cut(s) 45, 123, 155
Sfr274I CTCGAG 1 cut(s) 16
SlaI CTCGAG 1 cut(s) 16
SmiMI CAYNNNNRTG 1 cut(s) 132
SmlI CTYRAG 2 cut(s) 16, 86
SmoI CTYRAG 2 cut(s) 16, 86
Sse9I AATT 2 cut(s) 53, 233
StyD4I CCNGG 1 cut(s) 155
TaqI TCGA 2 cut(s) 17, 190
TasI AATT 2 cut(s) 53, 233
Tru1I TTAA 2 cut(s) 57, 186
Tru9I TTAA 2 cut(s) 57, 186
TspGWI ACGGA 1 cut(s) 201
XapI RAATTY 1 cut(s) 53
XceI RCATGY 1 cut(s) 131
XhoI CTCGAG 1 cut(s) 16
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.