Rroxscaffold_4G00301030

Serine arginine repetitive matrix protein

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
Physical Location & Seq
Forward (+)
21399599 .. 21404947
5349 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00301030.1

Sequence Viewer

Length: 504 bp
ATGGGTTTGAGAAAGCTAATTAACCATCAAAAGTGGAGGCAGTCATATATCTTTTTTGCATCTTTGGTTCTCGGATTTGCCTGTGTAATTCATCAAGTGCAAGAGGCCTCCAAGTACAAGGTAGAATTTGGATCTATTCCTGTTTTATGTATTAGTTGTGTCACCTATGAAGCCAGATTCCTCTGCTTCAACAATTCTGTAGACATGAGGAAGGCGAATATGGATTTTTTGCATCCATGTACTGCTAATAGAGTAACTGAGCTTCCTGGGTTTAAAGATGAAGTTCTTATCAACTTCATTCATGGTCTTTTGGATGTAAAGGTGCTTACTCTTGAGGAGCCTGAACGTGGTCTTACCATCGTCAAGCTAACGCATGTGGATGTTCCTGAAGAAGGCAGTGGCAGTCCATCACATCCAACAGCAAATGAAGCTTCCACTAACACAAAAGAGAACTTCCAAGCAGATGAACTAATGGCTGACACTGATGAAGATCTCATGCAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

167

Amino Acids

18.84

Weight (kDa)

5.18

Isoelectric Point (pI)

24.49

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 201
AclWI GGATC 1 cut(s) 139
AcsI RAATTY 1 cut(s) 125
AcuI CTGAAG 1 cut(s) 408
AfaI GTAC 2 cut(s) 116, 241
AfiI CCNNNNNNNGG 2 cut(s) 347, 392
AgsI TTSAA 1 cut(s) 190
AjnI CCWGG 1 cut(s) 265
AluBI AGCT 4 cut(s) 16, 262, 367, 431
AluI AGCT 4 cut(s) 16, 262, 367, 431
AlwI GGATC 1 cut(s) 139
AoxI GGCC 1 cut(s) 105
ApoI RAATTY 1 cut(s) 125
AsuHPI GGTGA 1 cut(s) 154
BarI GAAGNNNNNNTAC 2 cut(s) 246, 278
BccI CCATC 3 cut(s) 33, 365, 415
BciT130I CCWGG 1 cut(s) 267
BfmI CTRYAG 1 cut(s) 198
BglII AGATCT 1 cut(s) 490
Bme1390I CCNGG 1 cut(s) 267
BmiI GGNNCC 1 cut(s) 339
BmrFI CCNGG 1 cut(s) 267
BmsI GCATC 2 cut(s) 68, 241
BpuEI CTTGAG 1 cut(s) 353
BsaBI GATNNNNATC 1 cut(s) 489
BsaJI CCNNGG 1 cut(s) 266
Bsc4I CCNNNNNNNGG 2 cut(s) 347, 392
Bse8I GATNNNNATC 1 cut(s) 489
BseBI CCWGG 1 cut(s) 267
BseDI CCNNGG 1 cut(s) 266
BseGI GGATG 4 cut(s) 232, 319, 385, 412
BseJI GATNNNNATC 1 cut(s) 489
BseLI CCNNNNNNNGG 2 cut(s) 347, 392
BseMII CTCAG 1 cut(s) 249
BseRI GAGGAG 1 cut(s) 350
BshFI GGCC 1 cut(s) 107
BslI CCNNNNNNNGG 2 cut(s) 347, 392
BsnI GGCC 1 cut(s) 107
Bsp143I GATC 2 cut(s) 131, 490
BspANI GGCC 1 cut(s) 107
BspCNI CTCAG 1 cut(s) 250
BspLI GGNNCC 1 cut(s) 339
BspPI GGATC 1 cut(s) 139
BssECI CCNNGG 1 cut(s) 266
BssMI GATC 2 cut(s) 131, 490
Bst2UI CCWGG 1 cut(s) 267
BstDEI CTNAG 1 cut(s) 258
BstENI CCTNNNNNAGG 1 cut(s) 390
BstF5I GGATG 4 cut(s) 232, 319, 385, 412
BstKTI GATC 2 cut(s) 134, 493
BstMBI GATC 2 cut(s) 131, 490
BstMWI GCNNNNNNNGC 1 cut(s) 428
BstNI CCWGG 1 cut(s) 267
BstNSI RCATGY 1 cut(s) 377
BstSCI CCNGG 1 cut(s) 265
BstSFI CTRYAG 1 cut(s) 198
BstX2I RGATCY 2 cut(s) 131, 490
BstYI RGATCY 2 cut(s) 131, 490
BsuRI GGCC 1 cut(s) 107
BtsCI GGATG 4 cut(s) 232, 319, 385, 412
BtsI GCAGTG 1 cut(s) 403
BtsIMutI CAGTG 2 cut(s) 403, 480
Csp6I GTAC 2 cut(s) 115, 240
CviAII CATG 5 cut(s) 205, 237, 302, 374, 496
CviJI RGCY 8 cut(s) 16, 107, 173, 262, 340, 367, 431, 476
CviKI_1 RGCY 8 cut(s) 16, 107, 173, 262, 340, 367, 431, 476
CviQI GTAC 2 cut(s) 115, 240
DdeI CTNAG 1 cut(s) 258
DpnI GATC 2 cut(s) 133, 492
DpnII GATC 2 cut(s) 131, 490
DraI TTTAAA 1 cut(s) 274
Eco147I AGGCCT 1 cut(s) 107
Eco57I CTGAAG 1 cut(s) 408
EcoNI CCTNNNNNAGG 1 cut(s) 390
EcoRII CCWGG 1 cut(s) 265
FaeI CATG 5 cut(s) 208, 240, 305, 377, 499
FatI CATG 5 cut(s) 204, 236, 301, 373, 495
FblI GTMKAC 1 cut(s) 201
FokI GGATG 4 cut(s) 219, 326, 392, 399
HaeIII GGCC 1 cut(s) 107
Hin1II CATG 5 cut(s) 208, 240, 305, 377, 499
HindIII AAGCTT 1 cut(s) 429
HinfI GANTC 1 cut(s) 177
HphI GGTGA 1 cut(s) 154
Hpy166II GTNNAC 1 cut(s) 202
Hpy188I TCNGA 1 cut(s) 74
Hpy188III TCNNGA 2 cut(s) 332, 386
Hpy8I GTNNAC 1 cut(s) 202
HpyAV CCTTC 2 cut(s) 205, 386
HpyCH4IV ACGT 1 cut(s) 346
HpyCH4V TGCA 4 cut(s) 59, 100, 232, 499
HpyF10VI GCNNNNNNNGC 1 cut(s) 428
HpyF3I CTNAG 1 cut(s) 258
HpySE526I ACGT 1 cut(s) 346
Hsp92II CATG 5 cut(s) 208, 240, 305, 377, 499
Kzo9I GATC 2 cut(s) 131, 490
LmnI GCTCC 1 cut(s) 337
LpnPI CCDG 7 cut(s) 94, 153, 187, 252, 279, 354, 399
LweI GCATC 2 cut(s) 68, 241
MaeII ACGT 1 cut(s) 346
MaeIII GTNAC 2 cut(s) 160, 253
MalI GATC 2 cut(s) 133, 492
MboI GATC 2 cut(s) 131, 490
MboII GAAGA 2 cut(s) 401, 500
MflI RGATCY 2 cut(s) 131, 490
MluCI AATT 4 cut(s) 18, 87, 125, 193
MmeI TCCRAC 1 cut(s) 440
MnlI CCTC 6 cut(s) 30, 97, 118, 191, 201, 328
MseI TTAA 2 cut(s) 21, 273
MslI CAYNNNNRTG 1 cut(s) 378
MspR9I CCNGG 1 cut(s) 267
MvaI CCWGG 1 cut(s) 267
MwoI GCNNNNNNNGC 1 cut(s) 428
NdeII GATC 2 cut(s) 131, 490
NlaIII CATG 5 cut(s) 208, 240, 305, 377, 499
NlaIV GGNNCC 1 cut(s) 339
NmuCI GTSAC 1 cut(s) 160
NspI RCATGY 1 cut(s) 377
PceI AGGCCT 1 cut(s) 107
PfeI GAWTC 1 cut(s) 177
Psp6I CCWGG 1 cut(s) 265
PspGI CCWGG 1 cut(s) 265
PspN4I GGNNCC 1 cut(s) 339
PsuI RGATCY 2 cut(s) 131, 490
RsaI GTAC 2 cut(s) 116, 241
RsaNI GTAC 2 cut(s) 115, 240
RseI CAYNNNNRTG 1 cut(s) 378
SaqAI TTAA 2 cut(s) 21, 273
Sau3AI GATC 2 cut(s) 131, 490
ScrFI CCNGG 1 cut(s) 267
SetI ASST 8 cut(s) 18, 123, 167, 264, 324, 349, 369, 433
SfaNI GCATC 2 cut(s) 68, 241
SfcI CTRYAG 1 cut(s) 198
SmiMI CAYNNNNRTG 1 cut(s) 378
SmlI CTYRAG 1 cut(s) 332
SmoI CTYRAG 1 cut(s) 332
Sse9I AATT 4 cut(s) 18, 87, 125, 193
SseBI AGGCCT 1 cut(s) 107
StuI AGGCCT 1 cut(s) 107
StyD4I CCNGG 1 cut(s) 265
TaiI ACGT 1 cut(s) 349
TasI AATT 4 cut(s) 18, 87, 125, 193
TatI WGTACW 2 cut(s) 114, 239
TfiI GAWTC 1 cut(s) 177
Tru1I TTAA 2 cut(s) 21, 273
Tru9I TTAA 2 cut(s) 21, 273
TscAI CASTG 2 cut(s) 403, 487
TseFI GTSAC 1 cut(s) 160
Tsp45I GTSAC 1 cut(s) 160
TspDTI ATGAA 8 cut(s) 80, 183, 286, 290, 294, 441, 480, 501
TspRI CASTG 2 cut(s) 403, 487
XagI CCTNNNNNAGG 1 cut(s) 390
XapI RAATTY 1 cut(s) 125
XceI RCATGY 1 cut(s) 377
XmiI GTMKAC 1 cut(s) 201
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.