Rroxscaffold_2G00084810

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
Physical Location & Seq
Reverse (-)
7290955 .. 7299991
9037 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00084810.1

Sequence Viewer

Length: 282 bp
ATGAAAGGCAAAAAACAAGTAAATAGTATTGACCCAGTTGACTTCAACGGAAAAGGCGGTGAGATACTTGAAGGGGGAGACAAAGATGATGTAATCAAAGGTGGAGAGAATTGTGGGTTTTGTGGTGGACGTGGACTAGATGAAGGAACAGTCGAAGGTGATAGATCGGAAAAGGTGGACTTTGGCAATGGTGTACCCGTGAAAACTTCGGTGGAACCTAAAGTATCCGAGGATGGGCTTCTTGATGCTATTCGGCAGGATTACTTCCCATCCGCTCCATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

93

Amino Acids

9.77

Weight (kDa)

4.47

Isoelectric Point (pI)

28.56

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 275
AciI CCGC 2 cut(s) 57, 273
AfaI GTAC 1 cut(s) 195
AfiI CCNNNNNNNGG 1 cut(s) 234
AgsI TTSAA 2 cut(s) 46, 71
AjiI CACGTC 1 cut(s) 131
Alw26I GTCTC 1 cut(s) 72
AsuHPI GGTGA 2 cut(s) 71, 170
BccI CCATC 2 cut(s) 227, 277
BciVI GTATCC 1 cut(s) 235
BcoDI GTCTC 1 cut(s) 72
BfaI CTAG 1 cut(s) 137
BfuI GTATCC 1 cut(s) 235
BmgBI CACGTC 1 cut(s) 131
BmiI GGNNCC 1 cut(s) 216
BmrI ACTGGG 1 cut(s) 29
BmsI GCATC 1 cut(s) 235
BmuI ACTGGG 1 cut(s) 29
BsaJI CCNNGG 1 cut(s) 228
Bsc4I CCNNNNNNNGG 1 cut(s) 234
Bse1I ACTGG 1 cut(s) 35
Bse3DI GCAATG 1 cut(s) 193
BseDI CCNNGG 1 cut(s) 228
BseGI GGATG 2 cut(s) 238, 269
BseLI CCNNNNNNNGG 1 cut(s) 234
BseMI GCAATG 1 cut(s) 193
BseNI ACTGG 1 cut(s) 35
BslI CCNNNNNNNGG 1 cut(s) 234
BsmAI GTCTC 1 cut(s) 72
Bsp143I GATC 1 cut(s) 164
BspACI CCGC 2 cut(s) 57, 273
BspLI GGNNCC 1 cut(s) 216
BsrBI CCGCTC 1 cut(s) 275
BsrDI GCAATG 1 cut(s) 193
BsrI ACTGG 1 cut(s) 35
BssECI CCNNGG 1 cut(s) 228
BssMI GATC 1 cut(s) 164
Bst4CI ACNGT 1 cut(s) 151
BstF5I GGATG 2 cut(s) 238, 269
BstKTI GATC 1 cut(s) 167
BstMAI GTCTC 1 cut(s) 72
BstMBI GATC 1 cut(s) 164
BsuI GTATCC 1 cut(s) 235
BtrI CACGTC 1 cut(s) 131
BtsCI GGATG 2 cut(s) 238, 269
Csp6I GTAC 1 cut(s) 194
CviJI RGCY 1 cut(s) 238
CviKI_1 RGCY 1 cut(s) 238
CviQI GTAC 1 cut(s) 194
DpnI GATC 1 cut(s) 166
DpnII GATC 1 cut(s) 164
FaiI YATR 1 cut(s) 280
FalI AAGNNNNNCTT 2 cut(s) 164, 196
FokI GGATG 2 cut(s) 245, 256
FspBI CTAG 1 cut(s) 137
HincII GTYRAC 1 cut(s) 40
HindII GTYRAC 1 cut(s) 40
HphI GGTGA 2 cut(s) 71, 170
Hpy166II GTNNAC 5 cut(s) 40, 128, 134, 178, 194
Hpy188I TCNGA 2 cut(s) 169, 229
Hpy188III TCNNGA 1 cut(s) 242
Hpy8I GTNNAC 5 cut(s) 40, 128, 134, 178, 194
HpyAV CCTTC 3 cut(s) 65, 137, 149
HpyCH4III ACNGT 1 cut(s) 151
HpyCH4IV ACGT 1 cut(s) 130
HpySE526I ACGT 1 cut(s) 130
Kzo9I GATC 1 cut(s) 164
LmnI GCTCC 1 cut(s) 280
LpnPI CCDG 2 cut(s) 48, 242
LweI GCATC 1 cut(s) 235
MaeI CTAG 1 cut(s) 137
MaeII ACGT 1 cut(s) 130
MalI GATC 1 cut(s) 166
MbiI CCGCTC 1 cut(s) 275
MboI GATC 1 cut(s) 164
MluCI AATT 1 cut(s) 109
MnlI CCTC 1 cut(s) 223
NdeII GATC 1 cut(s) 164
NlaIV GGNNCC 1 cut(s) 216
PspN4I GGNNCC 1 cut(s) 216
RsaI GTAC 1 cut(s) 195
RsaNI GTAC 1 cut(s) 194
Sau3AI GATC 1 cut(s) 164
SetI ASST 5 cut(s) 103, 133, 160, 177, 220
SfaNI GCATC 1 cut(s) 235
Sse9I AATT 1 cut(s) 109
SsiI CCGC 2 cut(s) 57, 273
SspMI CTAG 1 cut(s) 137
TaaI ACNGT 1 cut(s) 151
TaiI ACGT 1 cut(s) 133
TaqI TCGA 1 cut(s) 153
TasI AATT 1 cut(s) 109
TspDTI ATGAA 2 cut(s) 17, 156
TspGWI ACGGA 1 cut(s) 63
XspI CTAG 1 cut(s) 137
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.