Rh7AG142900

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7A
Physical Location & Seq
Reverse (-)
11489840 .. 11502465
12626 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7AG142900.1

Sequence Viewer

Length: 237 bp
ATGGTGGATGTCAAACAGGCCCAGACAGCTTCACTTTGGCTTTGTTGTCAAATAATGTTGACTCTGATTTTCAAATCTGATAGTGCTGAAGAAGAATCCACACGAAGGGCTTTTAATGTGATTGACAATGAAGCTGAGAAAGACCACAAAGACGAGTCTAGTGGGGTTGAAGTTAGGTCTGTTGGGGGACCAGACGCTGCCATTGACAATGCTGCTGAGATGATTCCGCCAAAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

78

Amino Acids

8.54

Weight (kDa)

4.46

Isoelectric Point (pI)

48.21

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 227
AcuI CTGAAG 1 cut(s) 108
AfiI CCNNNNNNNGG 1 cut(s) 105
AgsI TTSAA 2 cut(s) 73, 170
AluBI AGCT 2 cut(s) 29, 134
AluI AGCT 2 cut(s) 29, 134
AlwNI CAGNNNCTG 1 cut(s) 197
AoxI GGCC 1 cut(s) 18
ApeKI GCWGC 2 cut(s) 197, 212
AspS9I GGNCC 2 cut(s) 19, 188
AvaII GGWCC 1 cut(s) 188
BbvI GCAGC 2 cut(s) 184, 199
BfaI CTAG 1 cut(s) 159
BisI GCNGC 2 cut(s) 198, 213
BlsI GCNGC 2 cut(s) 199, 214
Bme18I GGWCC 1 cut(s) 188
BmgT120I GGNCC 2 cut(s) 19, 188
BmiI GGNNCC 1 cut(s) 189
Bsc4I CCNNNNNNNGG 1 cut(s) 105
BseGI GGATG 1 cut(s) 13
BseLI CCNNNNNNNGG 1 cut(s) 105
BseMII CTCAG 2 cut(s) 126, 207
BseXI GCAGC 2 cut(s) 184, 199
BshFI GGCC 1 cut(s) 20
BslFI GGGAC 1 cut(s) 201
BslI CCNNNNNNNGG 1 cut(s) 105
BsmFI GGGAC 1 cut(s) 201
BsnI GGCC 1 cut(s) 20
BspACI CCGC 1 cut(s) 227
BspANI GGCC 1 cut(s) 20
BspCNI CTCAG 2 cut(s) 127, 208
BspLI GGNNCC 1 cut(s) 189
BstDEI CTNAG 2 cut(s) 135, 216
BstF5I GGATG 1 cut(s) 13
BstMWI GCNNNNNNNGC 1 cut(s) 26
BstV1I GCAGC 2 cut(s) 184, 199
BsuRI GGCC 1 cut(s) 20
BtsCI GGATG 1 cut(s) 13
CaiI CAGNNNCTG 1 cut(s) 197
Cfr13I GGNCC 2 cut(s) 19, 188
CseI GACGC 1 cut(s) 203
CviJI RGCY 5 cut(s) 20, 29, 40, 110, 134
CviKI_1 RGCY 5 cut(s) 20, 29, 40, 110, 134
DdeI CTNAG 2 cut(s) 135, 216
EciI GGCGGA 1 cut(s) 216
Eco47I GGWCC 1 cut(s) 188
Eco57I CTGAAG 1 cut(s) 108
FaqI GGGAC 1 cut(s) 201
Fnu4HI GCNGC 2 cut(s) 198, 213
FokI GGATG 1 cut(s) 20
Fsp4HI GCNGC 2 cut(s) 198, 213
FspBI CTAG 1 cut(s) 159
GluI GCNGC 2 cut(s) 198, 213
HaeIII GGCC 1 cut(s) 20
HgaI GACGC 1 cut(s) 203
HincII GTYRAC 1 cut(s) 60
HindII GTYRAC 1 cut(s) 60
HinfI GANTC 4 cut(s) 61, 95, 155, 223
Hpy166II GTNNAC 1 cut(s) 60
Hpy188I TCNGA 2 cut(s) 66, 79
Hpy8I GTNNAC 1 cut(s) 60
HpyAV CCTTC 1 cut(s) 99
HpyF10VI GCNNNNNNNGC 1 cut(s) 26
HpyF3I CTNAG 2 cut(s) 135, 216
LpnPI CCDG 3 cut(s) 2, 35, 204
Lsp1109I GCAGC 2 cut(s) 184, 199
MaeI CTAG 1 cut(s) 159
MboII GAAGA 2 cut(s) 101, 104
MlyI GAGTC 2 cut(s) 55, 164
MseI TTAA 1 cut(s) 114
MwoI GCNNNNNNNGC 1 cut(s) 26
NlaIV GGNNCC 1 cut(s) 189
PfeI GAWTC 2 cut(s) 95, 223
PkrI GCNGC 2 cut(s) 199, 214
PleI GAGTC 2 cut(s) 55, 163
PpsI GAGTC 2 cut(s) 55, 163
PspN4I GGNNCC 1 cut(s) 189
PspPI GGNCC 2 cut(s) 19, 188
PstNI CAGNNNCTG 1 cut(s) 197
SaqAI TTAA 1 cut(s) 114
SatI GCNGC 2 cut(s) 198, 213
Sau96I GGNCC 2 cut(s) 19, 188
SchI GAGTC 2 cut(s) 55, 164
SetI ASST 3 cut(s) 31, 136, 179
SgeI CNNG 6 cut(s) 29, 34, 114, 166, 171, 203
SinI GGWCC 1 cut(s) 188
SsiI CCGC 1 cut(s) 227
SspMI CTAG 1 cut(s) 159
TfiI GAWTC 2 cut(s) 95, 223
Tru1I TTAA 1 cut(s) 114
Tru9I TTAA 1 cut(s) 114
TseI GCWGC 2 cut(s) 197, 212
TspDTI ATGAA 1 cut(s) 144
VpaK11BI GGWCC 1 cut(s) 188
XspI CTAG 1 cut(s) 159
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.