Rh2BG151600

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2B
Physical Location & Seq
Forward (+)
12975378 .. 12976471
1094 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2BG151600.1

Sequence Viewer

Length: 192 bp
ATGGGAATTTTTGATGGATTGCCAGTGTCTCGAGACAAGGAATTCGAGCATACTGAGATATGTTACCTGGGTTCAAGCTCAAGAAACCATGCATTCAATTACAACACCAACTTTAACTATACAAGTTCTGTTCTAACTACTACTGTAACTAGAAAGCTTGATGACATCAAGCAAGCAGAAAAAGTAGTCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

63

Amino Acids

7.19

Weight (kDa)

6.02

Isoelectric Point (pI)

27.08

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 6, 41
AgsI TTSAA 2 cut(s) 75, 97
AjnI CCWGG 1 cut(s) 66
AluBI AGCT 2 cut(s) 78, 157
AluI AGCT 2 cut(s) 78, 157
Alw26I GTCTC 2 cut(s) 27, 33
Ama87I CYCGRG 1 cut(s) 30
ApoI RAATTY 2 cut(s) 6, 41
ArsI GACNNNNNNTTYG 2 cut(s) 26, 58
AvaI CYCGRG 1 cut(s) 30
BccI CCATC 1 cut(s) 8
BciT130I CCWGG 1 cut(s) 68
BcoDI GTCTC 2 cut(s) 27, 33
BfaI CTAG 2 cut(s) 150, 190
Bme1390I CCNGG 1 cut(s) 68
BmeT110I CYCGRG 1 cut(s) 30
BmrFI CCNGG 1 cut(s) 68
BpuEI CTTGAG 1 cut(s) 64
BsaJI CCNNGG 1 cut(s) 67
Bse1I ACTGG 1 cut(s) 23
BseBI CCWGG 1 cut(s) 68
BseDI CCNNGG 1 cut(s) 67
BseMII CTCAG 1 cut(s) 45
BseNI ACTGG 1 cut(s) 23
BsiHKCI CYCGRG 1 cut(s) 30
BsmAI GTCTC 2 cut(s) 27, 33
BsmI GAATGC 1 cut(s) 92
BsoBI CYCGRG 1 cut(s) 30
BspCNI CTCAG 1 cut(s) 46
BsrI ACTGG 1 cut(s) 23
BssECI CCNNGG 1 cut(s) 67
Bst2UI CCWGG 1 cut(s) 68
Bst4CI ACNGT 1 cut(s) 145
BstC8I GCNNGC 1 cut(s) 174
BstDEI CTNAG 1 cut(s) 54
BstMAI GTCTC 2 cut(s) 27, 33
BstNI CCWGG 1 cut(s) 68
BstSCI CCNGG 1 cut(s) 66
BtsIMutI CAGTG 1 cut(s) 30
Cac8I GCNNGC 1 cut(s) 174
CviAII CATG 1 cut(s) 89
CviJI RGCY 2 cut(s) 78, 157
CviKI_1 RGCY 2 cut(s) 78, 157
DdeI CTNAG 1 cut(s) 54
Eco88I CYCGRG 1 cut(s) 30
EcoRI GAATTC 1 cut(s) 41
EcoRII CCWGG 1 cut(s) 66
EcoT22I ATGCAT 1 cut(s) 94
FaeI CATG 1 cut(s) 92
FaiI YATR 4 cut(s) 51, 61, 90, 120
FatI CATG 1 cut(s) 88
FspBI CTAG 2 cut(s) 150, 190
FspEI CC 7 cut(s) 23, 36, 53, 54, 80, 101, 121
Hin1II CATG 1 cut(s) 92
HindIII AAGCTT 1 cut(s) 155
Hpy188III TCNNGA 3 cut(s) 30, 32, 81
HpyCH4III ACNGT 1 cut(s) 145
HpyCH4V TGCA 1 cut(s) 92
HpyF3I CTNAG 1 cut(s) 54
Hsp92II CATG 1 cut(s) 92
LpnPI CCDG 3 cut(s) 36, 53, 80
MaeI CTAG 2 cut(s) 150, 190
MaeIII GTNAC 2 cut(s) 62, 145
MluCI AATT 3 cut(s) 6, 41, 97
Mph1103I ATGCAT 1 cut(s) 94
MseI TTAA 1 cut(s) 114
MspR9I CCNGG 1 cut(s) 68
Mva1269I GAATGC 1 cut(s) 92
MvaI CCWGG 1 cut(s) 68
NlaIII CATG 1 cut(s) 92
NsiI ATGCAT 1 cut(s) 94
PaeR7I CTCGAG 1 cut(s) 30
PctI GAATGC 1 cut(s) 92
Psp6I CCWGG 1 cut(s) 66
PspGI CCWGG 1 cut(s) 66
SaqAI TTAA 1 cut(s) 114
ScrFI CCNGG 1 cut(s) 68
SetI ASST 3 cut(s) 69, 80, 159
Sfr274I CTCGAG 1 cut(s) 30
SlaI CTCGAG 1 cut(s) 30
SmlI CTYRAG 2 cut(s) 30, 79
SmoI CTYRAG 2 cut(s) 30, 79
Sse9I AATT 3 cut(s) 6, 41, 97
SspMI CTAG 2 cut(s) 150, 190
StyD4I CCNGG 1 cut(s) 66
TaaI ACNGT 1 cut(s) 145
TaqI TCGA 2 cut(s) 31, 45
TasI AATT 3 cut(s) 6, 41, 97
Tru1I TTAA 1 cut(s) 114
Tru9I TTAA 1 cut(s) 114
TscAI CASTG 1 cut(s) 30
TspRI CASTG 1 cut(s) 30
XapI RAATTY 2 cut(s) 6, 41
XhoI CTCGAG 1 cut(s) 30
XspI CTAG 2 cut(s) 150, 190
Zsp2I ATGCAT 1 cut(s) 94
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.