Rroxscaffold_4G00314700

Calcium-binding protein CML23

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
OG0002561
Physical Location & Seq
Forward (+)
38675961 .. 38676353
393 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00314700.1

Sequence Viewer

Length: 393 bp
ATGGGGTGGGAGATGAAGCCAGAGGAAGTGCAGACTCTGATGTCCGAGTTCGACAAGGACGGGGACGGCTACATCGACCTGGAGGAGTTCACAGAAATCATGAACAGATTGGGGTCGAGCAAGGATCTCCGTGATGCCTTCGATGTCTATGATCTCGACAAGGACGGCCTGATCTTGGCGAGCAAACTTCATGAGGTGCTCAACCGCTTAGGACTGAAGTGCTCGGTAGGGGAATGTGCCACCATGATCACTAAATTTGACGTCAATGGCGATGGTTGCGTTAACTTTCACGAGTTCAAGAAGATGATGAACTGCTCTAATCTATCAATTTCATCAAAAGCCATTTGGATTAGGATTTCGAATTCTTTATTGGGATTTGGGGTTAGGTTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04626 map04626
Pfam Domains
Protein Families
EF-hand_1

Protein Analysis

130

Amino Acids

14.72

Weight (kDa)

4.78

Isoelectric Point (pI)

31.38

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
EF-hand_7 PF13499 4 - 34 8.1e-08 EF-hand domain pair
EF-hand_8 PF13833 5 - 36 1.4e-08 EF-hand domain pair
EF-hand_1 PF00036 9 - 37 2.8e-09 EF hand domain
EF-hand_6 PF13405 13 - 38 5e-06 EF-hand domain
EF-hand_5 PF13202 13 - 34 5.6e-06 EF hand
EF-hand_7 PF13499 41 - 103 8.9e-13 EF-hand domain pair
EF-hand_1 PF00036 79 - 104 2.4e-07 EF hand domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 40
AatII GACGTC 1 cut(s) 264
AciI CCGC 1 cut(s) 205
AclWI GGATC 1 cut(s) 132
AcsI RAATTY 2 cut(s) 254, 361
AcuI CTGAAG 1 cut(s) 236
AcyI GRCGYC 1 cut(s) 261
AfiI CCNNNNNNNGG 1 cut(s) 175
AgsI TTSAA 1 cut(s) 298
AjnI CCWGG 1 cut(s) 78
AjuI GAANNNNNNNTTGG 2 cut(s) 353, 385
Alw21I GWGCWC 2 cut(s) 201, 224
AlwI GGATC 1 cut(s) 132
AlwNI CAGNNNCTG 1 cut(s) 37
AoxI GGCC 1 cut(s) 166
ApoI RAATTY 2 cut(s) 254, 361
AsuII TTCGAA 1 cut(s) 359
BauI CACGAG 1 cut(s) 290
Bbv12I GWGCWC 2 cut(s) 201, 224
BccI CCATC 1 cut(s) 266
BceAI ACGGC 2 cut(s) 82, 181
BciT130I CCWGG 1 cut(s) 80
BclI TGATCA 1 cut(s) 246
Bme1390I CCNGG 1 cut(s) 80
BmrFI CCNGG 1 cut(s) 80
BmsI GCATC 1 cut(s) 124
BpmI CTGGAG 1 cut(s) 101
Bpu10I CCTNAGC 1 cut(s) 208
Bpu14I TTCGAA 1 cut(s) 359
BsaHI GRCGYC 1 cut(s) 261
Bsc4I CCNNNNNNNGG 1 cut(s) 175
BseBI CCWGG 1 cut(s) 80
BseLI CCNNNNNNNGG 1 cut(s) 175
BseRI GAGGAG 1 cut(s) 98
BsgI GTGCAG 1 cut(s) 50
BshFI GGCC 1 cut(s) 168
BsiHKAI GWGCWC 2 cut(s) 201, 224
BslFI GGGAC 1 cut(s) 77
BslI CCNNNNNNNGG 1 cut(s) 175
BsmFI GGGAC 1 cut(s) 77
BsnI GGCC 1 cut(s) 168
Bsp119I TTCGAA 1 cut(s) 359
Bsp1286I GDGCHC 2 cut(s) 201, 224
Bsp143I GATC 4 cut(s) 124, 151, 171, 246
BspACI CCGC 1 cut(s) 205
BspANI GGCC 1 cut(s) 168
BspHI TCATGA 2 cut(s) 99, 190
BspPI GGATC 1 cut(s) 132
BspT104I TTCGAA 1 cut(s) 359
BssMI GATC 4 cut(s) 124, 151, 171, 246
BssNI GRCGYC 1 cut(s) 261
BssSI CACGAG 1 cut(s) 290
Bst2BI CACGAG 1 cut(s) 290
Bst2UI CCWGG 1 cut(s) 80
BstACI GRCGYC 1 cut(s) 261
BstBI TTCGAA 1 cut(s) 359
BstC8I GCNNGC 1 cut(s) 181
BstDEI CTNAG 1 cut(s) 208
BstKTI GATC 4 cut(s) 127, 154, 174, 249
BstMBI GATC 4 cut(s) 124, 151, 171, 246
BstMWI GCNNNNNNNGC 1 cut(s) 276
BstNI CCWGG 1 cut(s) 80
BstSCI CCNGG 1 cut(s) 78
BstX2I RGATCY 1 cut(s) 124
BstYI RGATCY 1 cut(s) 124
BsuRI GGCC 1 cut(s) 168
BtgZI GCGATG 1 cut(s) 285
Cac8I GCNNGC 1 cut(s) 181
CaiI CAGNNNCTG 1 cut(s) 37
CciI TCATGA 2 cut(s) 99, 190
CviAII CATG 3 cut(s) 100, 191, 244
CviJI RGCY 4 cut(s) 19, 69, 168, 341
CviKI_1 RGCY 4 cut(s) 19, 69, 168, 341
DdeI CTNAG 1 cut(s) 208
DpnI GATC 4 cut(s) 126, 153, 173, 248
DpnII GATC 4 cut(s) 124, 151, 171, 246
DrdI GACNNNNNNGTC 1 cut(s) 40
DseDI GACNNNNNNGTC 1 cut(s) 40
Eco57I CTGAAG 1 cut(s) 236
EcoRI GAATTC 1 cut(s) 361
EcoRII CCWGG 1 cut(s) 78
FaeI CATG 3 cut(s) 103, 194, 247
FaiI YATR 4 cut(s) 101, 150, 192, 245
FaqI GGGAC 1 cut(s) 77
FatI CATG 3 cut(s) 99, 190, 243
FbaI TGATCA 1 cut(s) 246
GsuI CTGGAG 1 cut(s) 101
HaeIII GGCC 1 cut(s) 168
Hin1I GRCGYC 1 cut(s) 261
Hin1II CATG 3 cut(s) 103, 194, 247
HincII GTYRAC 1 cut(s) 283
HindII GTYRAC 1 cut(s) 283
HinfI GANTC 1 cut(s) 34
HpaI GTTAAC 1 cut(s) 283
Hpy166II GTNNAC 2 cut(s) 90, 283
Hpy188I TCNGA 2 cut(s) 39, 46
Hpy188III TCNNGA 5 cut(s) 100, 155, 191, 290, 298
Hpy8I GTNNAC 2 cut(s) 90, 283
HpyAV CCTTC 1 cut(s) 148
HpyCH4IV ACGT 1 cut(s) 261
HpyCH4V TGCA 1 cut(s) 31
HpyF10VI GCNNNNNNNGC 1 cut(s) 276
HpyF3I CTNAG 1 cut(s) 208
HpySE526I ACGT 1 cut(s) 261
Hsp92I GRCGYC 1 cut(s) 261
Hsp92II CATG 3 cut(s) 103, 194, 247
Ksp22I TGATCA 1 cut(s) 246
KspAI GTTAAC 1 cut(s) 283
Kzo9I GATC 4 cut(s) 124, 151, 171, 246
LpnPI CCDG 4 cut(s) 33, 65, 92, 182
LweI GCATC 1 cut(s) 124
MaeII ACGT 1 cut(s) 261
MalI GATC 4 cut(s) 126, 153, 173, 248
MboI GATC 4 cut(s) 124, 151, 171, 246
MboII GAAGA 1 cut(s) 313
MflI RGATCY 1 cut(s) 124
MhlI GDGCHC 2 cut(s) 201, 224
MluCI AATT 3 cut(s) 254, 327, 361
MlyI GAGTC 1 cut(s) 28
MnlI CCTC 3 cut(s) 16, 76, 187
MseI TTAA 1 cut(s) 282
MspR9I CCNGG 1 cut(s) 80
MvaI CCWGG 1 cut(s) 80
MwoI GCNNNNNNNGC 1 cut(s) 276
NdeII GATC 4 cut(s) 124, 151, 171, 246
NlaIII CATG 3 cut(s) 103, 194, 247
NspV TTCGAA 1 cut(s) 359
PagI TCATGA 2 cut(s) 99, 190
PcsI WCGNNNNNNNCGW 2 cut(s) 72, 267
PleI GAGTC 1 cut(s) 28
PpsI GAGTC 1 cut(s) 28
Psp6I CCWGG 1 cut(s) 78
PspGI CCWGG 1 cut(s) 78
PstNI CAGNNNCTG 1 cut(s) 37
PsuI RGATCY 1 cut(s) 124
SaqAI TTAA 1 cut(s) 282
Sau3AI GATC 4 cut(s) 124, 151, 171, 246
SchI GAGTC 1 cut(s) 28
ScrFI CCNGG 1 cut(s) 80
SduI GDGCHC 2 cut(s) 201, 224
SetI ASST 4 cut(s) 81, 198, 264, 389
SfaNI GCATC 1 cut(s) 124
SfuI TTCGAA 1 cut(s) 359
Sse9I AATT 3 cut(s) 254, 327, 361
SsiI CCGC 1 cut(s) 205
StyD4I CCNGG 1 cut(s) 78
TaiI ACGT 1 cut(s) 264
TaqI TCGA 6 cut(s) 51, 75, 116, 141, 156, 359
TasI AATT 3 cut(s) 254, 327, 361
Tru1I TTAA 1 cut(s) 282
Tru9I TTAA 1 cut(s) 282
TspDTI ATGAA 5 cut(s) 29, 116, 179, 321, 323
TspGWI ACGGA 1 cut(s) 119
XapI RAATTY 2 cut(s) 254, 361
ZraI GACGTC 1 cut(s) 262
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.