Rh6DG456800

calcium-binding protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6D
Physical Location & Seq
Reverse (-)
62727904 .. 62728125
222 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6DG456800.1

Sequence Viewer

Length: 222 bp
ATGAATGGATCGGCGTGGAGCAAGGATCTTCGTGACACCTTTGATGTCTACGATCTCGACAAGAACTGTCTGATCTCGGCGAGTGAACTTCATGAGGTGCTCAACCTGTTAGGGCAGAAGTGCTCCGTTGGGGAATGTGCCACCATGATCACCAAATTTGACTTCAATGGCGATGACTTCGTTAATTTTCAAGAGTTCAAAACGATGATGAACCGCTTTTGA

Protein Analysis

73

Amino Acids

8.4

Weight (kDa)

4.51

Isoelectric Point (pI)

17.21

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
EF-hand_7 PF13499 8 - 70 2.7e-11 EF-hand domain pair
EF-hand_8 PF13833 25 - 72 3.7e-06 EF-hand domain pair
EF-hand_1 PF00036 46 - 72 5e-06 EF hand domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 48
AciI CCGC 1 cut(s) 214
AclWI GGATC 2 cut(s) 16, 33
AcsI RAATTY 1 cut(s) 155
AgsI TTSAA 3 cut(s) 166, 191, 199
AjuI GAANNNNNNNTTGG 2 cut(s) 146, 178
Alw21I GWGCWC 2 cut(s) 102, 125
AlwI GGATC 2 cut(s) 16, 33
ApoI RAATTY 1 cut(s) 155
AsuHPI GGTGA 1 cut(s) 142
Bbv12I GWGCWC 2 cut(s) 102, 125
BclI TGATCA 1 cut(s) 147
BsiHKAI GWGCWC 2 cut(s) 102, 125
Bsp1286I GDGCHC 2 cut(s) 102, 125
Bsp143I GATC 5 cut(s) 8, 25, 52, 72, 147
BspACI CCGC 1 cut(s) 214
BspHI TCATGA 1 cut(s) 91
BspPI GGATC 2 cut(s) 16, 33
BssMI GATC 5 cut(s) 8, 25, 52, 72, 147
Bst4CI ACNGT 1 cut(s) 68
BstKTI GATC 5 cut(s) 11, 28, 55, 75, 150
BstMBI GATC 5 cut(s) 8, 25, 52, 72, 147
BstX2I RGATCY 1 cut(s) 25
BstYI RGATCY 1 cut(s) 25
BtgZI GCGATG 1 cut(s) 186
CciI TCATGA 1 cut(s) 91
CviAII CATG 2 cut(s) 92, 145
DpnI GATC 5 cut(s) 10, 27, 54, 74, 149
DpnII GATC 5 cut(s) 8, 25, 52, 72, 147
FaeI CATG 2 cut(s) 95, 148
FaiI YATR 2 cut(s) 93, 146
FatI CATG 2 cut(s) 91, 144
FbaI TGATCA 1 cut(s) 147
FblI GTMKAC 1 cut(s) 48
Hin1II CATG 2 cut(s) 95, 148
HphI GGTGA 1 cut(s) 142
Hpy166II GTNNAC 2 cut(s) 49, 86
Hpy188I TCNGA 1 cut(s) 72
Hpy188III TCNNGA 4 cut(s) 32, 56, 92, 191
Hpy8I GTNNAC 2 cut(s) 49, 86
HpyCH4III ACNGT 1 cut(s) 68
Hsp92II CATG 2 cut(s) 95, 148
Ksp22I TGATCA 1 cut(s) 147
Kzo9I GATC 5 cut(s) 8, 25, 52, 72, 147
LmnI GCTCC 2 cut(s) 18, 128
LpnPI CCDG 1 cut(s) 119
MaeIII GTNAC 1 cut(s) 32
MalI GATC 5 cut(s) 10, 27, 54, 74, 149
MboI GATC 5 cut(s) 8, 25, 52, 72, 147
MboII GAAGA 1 cut(s) 20
MflI RGATCY 1 cut(s) 25
MhlI GDGCHC 2 cut(s) 102, 125
MluCI AATT 2 cut(s) 155, 184
MnlI CCTC 1 cut(s) 88
MseI TTAA 1 cut(s) 183
NdeII GATC 5 cut(s) 8, 25, 52, 72, 147
NlaIII CATG 2 cut(s) 95, 148
NmeAIII GCCGAG 1 cut(s) 56
NmuCI GTSAC 1 cut(s) 32
PagI TCATGA 1 cut(s) 91
PsuI RGATCY 1 cut(s) 25
SaqAI TTAA 1 cut(s) 183
Sau3AI GATC 5 cut(s) 8, 25, 52, 72, 147
SduI GDGCHC 2 cut(s) 102, 125
SetI ASST 3 cut(s) 41, 99, 108
Sse9I AATT 2 cut(s) 155, 184
SsiI CCGC 1 cut(s) 214
TaaI ACNGT 1 cut(s) 68
TaqI TCGA 1 cut(s) 57
TasI AATT 2 cut(s) 155, 184
Tru1I TTAA 1 cut(s) 183
Tru9I TTAA 1 cut(s) 183
TseFI GTSAC 1 cut(s) 32
Tsp45I GTSAC 1 cut(s) 32
TspDTI ATGAA 2 cut(s) 17, 80
TspGWI ACGGA 1 cut(s) 115
XapI RAATTY 1 cut(s) 155
XmiI GTMKAC 1 cut(s) 48
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.