Rh1BG121800

calcium-binding protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1B
OG0002561
Physical Location & Seq
Reverse (-)
20659311 .. 20659618
308 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1BG121800.1

Sequence Viewer

Length: 222 bp
ATGAATGGATCGGGGTCGAGCAAGGATCTCCGTGATGCCTTCGATGTCTACGATCTCGACAAGAACGGCCTGATCTCGGCGAGCGAACTTCATGAGGTGCTCAACCGCTTAGGACAGAAGTGCTCGGTCGGGGAATGTGCCACCATGATCACCAAATTTGACGTCGATGGTGATGGCTGCGTTAACTTTCACGAGTTCAAGAAGATGATGAACTGCTCTTGA

Protein Analysis

73

Amino Acids

8.02

Weight (kDa)

4.88

Isoelectric Point (pI)

18.38

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
EF-hand_7 PF13499 8 - 70 1.6e-15 EF-hand domain pair
EF-hand_1 PF00036 9 - 36 9e-07 EF hand domain
EF-hand_6 PF13405 9 - 38 1.2e-07 EF-hand domain
EF-hand_5 PF13202 10 - 33 4.7e-06 EF hand
EF-hand_8 PF13833 37 - 71 3.4e-06 EF-hand domain pair
EF-hand_1 PF00036 46 - 71 5e-08 EF hand domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 165
AccI GTMKAC 1 cut(s) 48
AciI CCGC 1 cut(s) 106
AclWI GGATC 2 cut(s) 16, 33
AcsI RAATTY 1 cut(s) 155
AcyI GRCGYC 1 cut(s) 162
AfiI CCNNNNNNNGG 1 cut(s) 76
AgsI TTSAA 1 cut(s) 199
Alw21I GWGCWC 2 cut(s) 102, 125
AlwI GGATC 2 cut(s) 16, 33
AoxI GGCC 1 cut(s) 67
ApeKI GCWGC 1 cut(s) 177
ApoI RAATTY 1 cut(s) 155
ArsI GACNNNNNNTTYG 2 cut(s) 147, 179
AsuHPI GGTGA 2 cut(s) 142, 182
BauI CACGAG 1 cut(s) 191
Bbv12I GWGCWC 2 cut(s) 102, 125
BbvI GCAGC 1 cut(s) 164
BccI CCATC 2 cut(s) 161, 167
BceAI ACGGC 1 cut(s) 82
BclI TGATCA 1 cut(s) 147
BisI GCNGC 1 cut(s) 178
BlsI GCNGC 1 cut(s) 179
BmsI GCATC 1 cut(s) 25
Bpu10I CCTNAGC 1 cut(s) 109
BsaHI GRCGYC 1 cut(s) 162
Bsc4I CCNNNNNNNGG 1 cut(s) 76
BseLI CCNNNNNNNGG 1 cut(s) 76
BseXI GCAGC 1 cut(s) 164
Bsh1285I CGRYCG 1 cut(s) 129
BshFI GGCC 1 cut(s) 69
BsiEI CGRYCG 1 cut(s) 129
BsiHKAI GWGCWC 2 cut(s) 102, 125
BslI CCNNNNNNNGG 1 cut(s) 76
BsnI GGCC 1 cut(s) 69
Bsp1286I GDGCHC 2 cut(s) 102, 125
Bsp143I GATC 5 cut(s) 8, 25, 52, 72, 147
BspACI CCGC 1 cut(s) 106
BspANI GGCC 1 cut(s) 69
BspHI TCATGA 1 cut(s) 91
BspPI GGATC 2 cut(s) 16, 33
BssMI GATC 5 cut(s) 8, 25, 52, 72, 147
BssNI GRCGYC 1 cut(s) 162
BssSI CACGAG 1 cut(s) 191
Bst2BI CACGAG 1 cut(s) 191
BstACI GRCGYC 1 cut(s) 162
BstC8I GCNNGC 1 cut(s) 82
BstDEI CTNAG 1 cut(s) 109
BstKTI GATC 5 cut(s) 11, 28, 55, 75, 150
BstMBI GATC 5 cut(s) 8, 25, 52, 72, 147
BstMCI CGRYCG 1 cut(s) 129
BstV1I GCAGC 1 cut(s) 164
BstX2I RGATCY 1 cut(s) 25
BstYI RGATCY 1 cut(s) 25
BsuRI GGCC 1 cut(s) 69
Cac8I GCNNGC 1 cut(s) 82
CciI TCATGA 1 cut(s) 91
CviAII CATG 2 cut(s) 92, 145
CviJI RGCY 2 cut(s) 69, 177
CviKI_1 RGCY 2 cut(s) 69, 177
DdeI CTNAG 1 cut(s) 109
DpnI GATC 5 cut(s) 10, 27, 54, 74, 149
DpnII GATC 5 cut(s) 8, 25, 52, 72, 147
FaeI CATG 2 cut(s) 95, 148
FaiI YATR 2 cut(s) 93, 146
FatI CATG 2 cut(s) 91, 144
FbaI TGATCA 1 cut(s) 147
FblI GTMKAC 1 cut(s) 48
Fnu4HI GCNGC 1 cut(s) 178
Fsp4HI GCNGC 1 cut(s) 178
GluI GCNGC 1 cut(s) 178
HaeIII GGCC 1 cut(s) 69
Hin1I GRCGYC 1 cut(s) 162
Hin1II CATG 2 cut(s) 95, 148
HincII GTYRAC 1 cut(s) 184
HindII GTYRAC 1 cut(s) 184
HpaI GTTAAC 1 cut(s) 184
HphI GGTGA 2 cut(s) 142, 182
Hpy166II GTNNAC 2 cut(s) 49, 184
Hpy188III TCNNGA 5 cut(s) 56, 92, 191, 199, 219
Hpy8I GTNNAC 2 cut(s) 49, 184
Hpy99I CGWCG 1 cut(s) 167
HpyAV CCTTC 1 cut(s) 49
HpyCH4IV ACGT 1 cut(s) 162
HpyF3I CTNAG 1 cut(s) 109
HpySE526I ACGT 1 cut(s) 162
Hsp92I GRCGYC 1 cut(s) 162
Hsp92II CATG 2 cut(s) 95, 148
Ksp22I TGATCA 1 cut(s) 147
KspAI GTTAAC 1 cut(s) 184
Kzo9I GATC 5 cut(s) 8, 25, 52, 72, 147
LpnPI CCDG 1 cut(s) 83
Lsp1109I GCAGC 1 cut(s) 164
LweI GCATC 1 cut(s) 25
MaeII ACGT 1 cut(s) 162
MalI GATC 5 cut(s) 10, 27, 54, 74, 149
MboI GATC 5 cut(s) 8, 25, 52, 72, 147
MboII GAAGA 1 cut(s) 214
MflI RGATCY 1 cut(s) 25
MhlI GDGCHC 2 cut(s) 102, 125
MluCI AATT 1 cut(s) 155
MnlI CCTC 1 cut(s) 88
MseI TTAA 1 cut(s) 183
NdeII GATC 5 cut(s) 8, 25, 52, 72, 147
NlaIII CATG 2 cut(s) 95, 148
NmeAIII GCCGAG 1 cut(s) 56
PagI TCATGA 1 cut(s) 91
PcsI WCGNNNNNNNCGW 1 cut(s) 48
PkrI GCNGC 1 cut(s) 179
PsuI RGATCY 1 cut(s) 25
SaqAI TTAA 1 cut(s) 183
SatI GCNGC 1 cut(s) 178
Sau3AI GATC 5 cut(s) 8, 25, 52, 72, 147
SduI GDGCHC 2 cut(s) 102, 125
SetI ASST 2 cut(s) 99, 165
SfaNI GCATC 1 cut(s) 25
Sse9I AATT 1 cut(s) 155
SsiI CCGC 1 cut(s) 106
TaiI ACGT 1 cut(s) 165
TaqI TCGA 4 cut(s) 17, 42, 57, 165
TaqII GACCGA 1 cut(s) 115
TasI AATT 1 cut(s) 155
Tru1I TTAA 1 cut(s) 183
Tru9I TTAA 1 cut(s) 183
TseI GCWGC 1 cut(s) 177
TspDTI ATGAA 2 cut(s) 17, 80
TspGWI ACGGA 1 cut(s) 20
XapI RAATTY 1 cut(s) 155
XmiI GTMKAC 1 cut(s) 48
ZraI GACGTC 1 cut(s) 163
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.