Rroxscaffold_7G00188180

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
OG0001968
Physical Location & Seq
Reverse (-)
27731555 .. 27733602
2048 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00188180.1

Sequence Viewer

Length: 369 bp
ATGACTCGACCGACTCCATATATAGCTACCCCGACTCACTCCACGGCCCTAAACCTTAAATCCACTTCCTCCGAAGGCCGACTACGGTGCGAAGCTTTCGAAGCCCTAAGTTGGAGATTTGTCTTCGAATCGGTCGACGGAAGATTTCGGTGGATTGTTGTTGGACGAGAACCTAGTGGCACAAGCTATCAAGTTCTTGCTAGAAACGAAACATGTTCTAATATCAAATTTATCAGCTATAGGAAATGGAACGATCCTTTTCTTGCTGCTGATTCTCGGGCAAACAAGGAAGCAGTTGATGAATGTTCTGTTTTTGTTGGGAATGGTGATATTGATTGGAAACTGAAGTTTAAAGTTGATATTGATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

122

Amino Acids

13.92

Weight (kDa)

7.7

Isoelectric Point (pI)

25.51

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 135
AclWI GGATC 1 cut(s) 248
AcsI RAATTY 1 cut(s) 227
AcuI CTGAAG 1 cut(s) 365
AfiI CCNNNNNNNGG 1 cut(s) 111
AflIII ACRYGT 1 cut(s) 212
AluBI AGCT 4 cut(s) 26, 95, 186, 237
AluI AGCT 4 cut(s) 26, 95, 186, 237
AlwI GGATC 1 cut(s) 248
Ama87I CYCGRG 1 cut(s) 276
AoxI GGCC 2 cut(s) 45, 76
ApeKI GCWGC 1 cut(s) 266
ApoI RAATTY 1 cut(s) 227
AspS9I GGNCC 1 cut(s) 46
AsuHPI GGTGA 1 cut(s) 338
AsuII TTCGAA 2 cut(s) 99, 126
AvaI CYCGRG 1 cut(s) 276
BarI GAAGNNNNNNTAC 2 cut(s) 66, 98
BbsI GAAGAC 1 cut(s) 115
BbvI GCAGC 1 cut(s) 253
BceAI ACGGC 1 cut(s) 60
BcgI CGANNNNNNTGC 2 cut(s) 69, 103
BfaI CTAG 2 cut(s) 174, 201
BfmI CTRYAG 1 cut(s) 238
BisI GCNGC 1 cut(s) 267
BlsI GCNGC 1 cut(s) 268
BmeT110I CYCGRG 1 cut(s) 276
BmgT120I GGNCC 1 cut(s) 46
BpiI GAAGAC 1 cut(s) 115
Bpu14I TTCGAA 2 cut(s) 99, 126
BsaJI CCNNGG 1 cut(s) 42
Bsc4I CCNNNNNNNGG 1 cut(s) 111
BseDI CCNNGG 1 cut(s) 42
BseLI CCNNNNNNNGG 1 cut(s) 111
BseXI GCAGC 1 cut(s) 253
Bsh1285I CGRYCG 2 cut(s) 11, 135
BshFI GGCC 2 cut(s) 47, 78
BsiEI CGRYCG 2 cut(s) 11, 135
BsiHKCI CYCGRG 1 cut(s) 276
BslI CCNNNNNNNGG 1 cut(s) 111
BsnI GGCC 2 cut(s) 47, 78
BsoBI CYCGRG 1 cut(s) 276
Bsp119I TTCGAA 2 cut(s) 99, 126
Bsp143I GATC 1 cut(s) 253
BspANI GGCC 2 cut(s) 47, 78
BspPI GGATC 1 cut(s) 248
BspT104I TTCGAA 2 cut(s) 99, 126
BssECI CCNNGG 1 cut(s) 42
BssMI GATC 1 cut(s) 253
Bst4CI ACNGT 1 cut(s) 87
BstBI TTCGAA 2 cut(s) 99, 126
BstDEI CTNAG 1 cut(s) 107
BstDSI CCRYGG 1 cut(s) 42
BstKTI GATC 1 cut(s) 256
BstMBI GATC 1 cut(s) 253
BstMCI CGRYCG 2 cut(s) 11, 135
BstMWI GCNNNNNNNGC 1 cut(s) 101
BstNSI RCATGY 1 cut(s) 216
BstSFI CTRYAG 1 cut(s) 238
BstV1I GCAGC 1 cut(s) 253
BstV2I GAAGAC 1 cut(s) 115
BsuRI GGCC 2 cut(s) 47, 78
BtgI CCRYGG 1 cut(s) 42
Cfr13I GGNCC 1 cut(s) 46
CviAII CATG 1 cut(s) 213
CviJI RGCY 7 cut(s) 26, 47, 78, 95, 104, 186, 237
CviKI_1 RGCY 7 cut(s) 26, 47, 78, 95, 104, 186, 237
DdeI CTNAG 1 cut(s) 107
DpnI GATC 1 cut(s) 255
DpnII GATC 1 cut(s) 253
DraI TTTAAA 1 cut(s) 352
Eco57I CTGAAG 1 cut(s) 365
Eco88I CYCGRG 1 cut(s) 276
FaeI CATG 1 cut(s) 216
FaiI YATR 5 cut(s) 19, 21, 23, 214, 240
FatI CATG 1 cut(s) 212
FblI GTMKAC 1 cut(s) 135
Fnu4HI GCNGC 1 cut(s) 267
Fsp4HI GCNGC 1 cut(s) 267
FspBI CTAG 2 cut(s) 174, 201
GluI GCNGC 1 cut(s) 267
HaeIII GGCC 2 cut(s) 47, 78
Hin1II CATG 1 cut(s) 216
HincII GTYRAC 1 cut(s) 136
HindII GTYRAC 1 cut(s) 136
HindIII AAGCTT 1 cut(s) 93
HinfI GANTC 5 cut(s) 4, 13, 34, 128, 272
HphI GGTGA 1 cut(s) 338
Hpy166II GTNNAC 1 cut(s) 136
Hpy188I TCNGA 1 cut(s) 73
Hpy8I GTNNAC 1 cut(s) 136
Hpy99I CGWCG 1 cut(s) 140
HpyAV CCTTC 1 cut(s) 68
HpyCH4III ACNGT 1 cut(s) 87
HpyF10VI GCNNNNNNNGC 1 cut(s) 101
HpyF3I CTNAG 1 cut(s) 107
Hsp92II CATG 1 cut(s) 216
Kzo9I GATC 1 cut(s) 253
Lsp1109I GCAGC 1 cut(s) 253
MaeI CTAG 2 cut(s) 174, 201
MalI GATC 1 cut(s) 255
MboI GATC 1 cut(s) 253
MboII GAAGA 2 cut(s) 115, 153
MluCI AATT 1 cut(s) 227
MlyI GAGTC 2 cut(s) 7, 28
MmeI TCCRAC 2 cut(s) 92, 142
MnlI CCTC 1 cut(s) 79
MseI TTAA 2 cut(s) 57, 351
MwoI GCNNNNNNNGC 1 cut(s) 101
NdeII GATC 1 cut(s) 253
NlaIII CATG 1 cut(s) 216
NspI RCATGY 1 cut(s) 216
NspV TTCGAA 2 cut(s) 99, 126
PciI ACATGT 1 cut(s) 212
PcsI WCGNNNNNNNCGW 1 cut(s) 132
PfeI GAWTC 2 cut(s) 128, 272
PkrI GCNGC 1 cut(s) 268
PleI GAGTC 2 cut(s) 7, 28
PpsI GAGTC 2 cut(s) 7, 28
PscI ACATGT 1 cut(s) 212
PspPI GGNCC 1 cut(s) 46
SalI GTCGAC 1 cut(s) 134
SaqAI TTAA 2 cut(s) 57, 351
SatI GCNGC 1 cut(s) 267
Sau3AI GATC 1 cut(s) 253
Sau96I GGNCC 1 cut(s) 46
SchI GAGTC 2 cut(s) 7, 28
SetI ASST 6 cut(s) 28, 57, 97, 175, 188, 239
SfcI CTRYAG 1 cut(s) 238
SfuI TTCGAA 2 cut(s) 99, 126
Sse9I AATT 1 cut(s) 227
SspMI CTAG 2 cut(s) 174, 201
TaaI ACNGT 1 cut(s) 87
TaqI TCGA 4 cut(s) 7, 99, 126, 135
TaqII GACCGA 2 cut(s) 25, 121
TasI AATT 1 cut(s) 227
TfiI GAWTC 2 cut(s) 128, 272
Tru1I TTAA 2 cut(s) 57, 351
Tru9I TTAA 2 cut(s) 57, 351
TseI GCWGC 1 cut(s) 266
TspDTI ATGAA 1 cut(s) 315
TspGWI ACGGA 1 cut(s) 153
XapI RAATTY 1 cut(s) 227
XceI RCATGY 1 cut(s) 216
XmiI GTMKAC 1 cut(s) 135
XspI CTAG 2 cut(s) 174, 201
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.