Rorug02G0617400

Dehydration-responsive element-binding protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000002
OG0003740
Physical Location & Seq
Reverse (-)
73554340 .. 73556127
1788 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug02G0617400.1

Sequence Viewer

Length: 369 bp
ATGGACGACAGCAGTTTCCCTGTTCCTCACAAGAAGTTCTCGTTGGAAATCAAGGGGAACAAAACAGATGTGGTGATTTGCTGTTATGATGATCACTTCCTTGTCATTGCAACTCAAATAGGAACTATGGGGACCATACTGCAAGCCAGTAAGGAGGAAGGTGCAACATTCAATCCAACTTACAGCGTGTCTGTAATCTTTGGCAAGCGAGATGAGCCAATGCTAGAGGCCTGCGCTCGTCAACTTGTGGAACATATCAGTAATTCGCGCTCTTCCAGGCCATTGTTGCTTTCTCTTGGTCTCAAAGACCATTCAGTGGAGACACTGAAAGGCATTGTATCTGCTGTAATCGAAAATCGCCTTTGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
AP2

Protein Analysis

122

Amino Acids

13.52

Weight (kDa)

6.05

Isoelectric Point (pI)

50.35

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PAC3 PF10178 35 - 119 4.8e-32 Proteasome assembly chaperone 3
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 316
AccII CGCG 1 cut(s) 268
AfiI CCNNNNNNNGG 1 cut(s) 316
AgsI TTSAA 1 cut(s) 172
AjnI CCWGG 1 cut(s) 275
AjuI GAANNNNNNNTTGG 2 cut(s) 26, 58
Alw26I GTCTC 2 cut(s) 305, 314
AoxI GGCC 2 cut(s) 228, 278
AspLEI GCGC 2 cut(s) 236, 270
AspS9I GGNCC 1 cut(s) 132
AsuHPI GGTGA 1 cut(s) 85
AvaII GGWCC 1 cut(s) 132
BciT130I CCWGG 1 cut(s) 277
BclI TGATCA 1 cut(s) 91
BcoDI GTCTC 2 cut(s) 305, 314
BfaI CTAG 1 cut(s) 224
Bme1390I CCNGG 1 cut(s) 277
Bme18I GGWCC 1 cut(s) 132
BmgT120I GGNCC 1 cut(s) 132
BmiI GGNNCC 1 cut(s) 133
BmrFI CCNGG 1 cut(s) 277
BsaI GGTCTC 1 cut(s) 305
Bsc4I CCNNNNNNNGG 1 cut(s) 316
Bse1I ACTGG 1 cut(s) 147
Bse3DI GCAATG 1 cut(s) 105
BseBI CCWGG 1 cut(s) 277
BseLI CCNNNNNNNGG 1 cut(s) 316
BseMI GCAATG 1 cut(s) 105
BseNI ACTGG 1 cut(s) 147
Bsh1236I CGCG 1 cut(s) 268
BshFI GGCC 2 cut(s) 230, 280
BslFI GGGAC 1 cut(s) 145
BslI CCNNNNNNNGG 1 cut(s) 316
BsmAI GTCTC 2 cut(s) 305, 314
BsmFI GGGAC 1 cut(s) 145
BsnI GGCC 2 cut(s) 230, 280
Bso31I GGTCTC 1 cut(s) 305
Bsp143I GATC 1 cut(s) 91
BspANI GGCC 2 cut(s) 230, 280
BspFNI CGCG 1 cut(s) 268
BspLI GGNNCC 1 cut(s) 133
BspQI GCTCTTC 1 cut(s) 277
BspTNI GGTCTC 1 cut(s) 305
BsrDI GCAATG 1 cut(s) 105
BsrI ACTGG 1 cut(s) 147
BssMI GATC 1 cut(s) 91
Bst2UI CCWGG 1 cut(s) 277
Bst6I CTCTTC 1 cut(s) 277
BstC8I GCNNGC 3 cut(s) 144, 206, 232
BstFNI CGCG 1 cut(s) 268
BstHHI GCGC 2 cut(s) 236, 270
BstKTI GATC 1 cut(s) 94
BstMAI GTCTC 2 cut(s) 305, 314
BstMBI GATC 1 cut(s) 91
BstMWI GCNNNNNNNGC 2 cut(s) 214, 286
BstNI CCWGG 1 cut(s) 277
BstSCI CCNGG 1 cut(s) 275
BstUI CGCG 1 cut(s) 268
BsuRI GGCC 2 cut(s) 230, 280
BtsIMutI CAGTG 2 cut(s) 321, 323
Cac8I GCNNGC 3 cut(s) 144, 206, 232
CfoI GCGC 2 cut(s) 236, 270
Cfr13I GGNCC 1 cut(s) 132
CviJI RGCY 4 cut(s) 146, 217, 230, 280
CviKI_1 RGCY 4 cut(s) 146, 217, 230, 280
DpnI GATC 1 cut(s) 93
DpnII GATC 1 cut(s) 91
Eam1104I CTCTTC 1 cut(s) 277
EarI CTCTTC 1 cut(s) 277
Eco147I AGGCCT 1 cut(s) 230
Eco31I GGTCTC 1 cut(s) 305
Eco47I GGWCC 1 cut(s) 132
EcoRII CCWGG 1 cut(s) 275
FaiI YATR 4 cut(s) 87, 128, 137, 255
FaqI GGGAC 1 cut(s) 145
FbaI TGATCA 1 cut(s) 91
FspBI CTAG 1 cut(s) 224
GlaI GCGC 2 cut(s) 235, 269
HaeIII GGCC 2 cut(s) 230, 280
HhaI GCGC 2 cut(s) 236, 270
Hin6I GCGC 2 cut(s) 234, 268
HinP1I GCGC 2 cut(s) 234, 268
HincII GTYRAC 1 cut(s) 242
HindII GTYRAC 1 cut(s) 242
HphI GGTGA 1 cut(s) 85
Hpy166II GTNNAC 1 cut(s) 242
Hpy8I GTNNAC 1 cut(s) 242
HpyAV CCTTC 1 cut(s) 152
HpyCH4V TGCA 3 cut(s) 110, 142, 164
HpyF10VI GCNNNNNNNGC 2 cut(s) 214, 286
HspAI GCGC 2 cut(s) 234, 268
Ksp22I TGATCA 1 cut(s) 91
Kzo9I GATC 1 cut(s) 91
LguI GCTCTTC 1 cut(s) 277
LpnPI CCDG 5 cut(s) 33, 160, 244, 262, 289
MaeI CTAG 1 cut(s) 224
MalI GATC 1 cut(s) 93
MboI GATC 1 cut(s) 91
MboII GAAGA 1 cut(s) 264
MluCI AATT 1 cut(s) 262
MmeI TCCRAC 2 cut(s) 24, 200
MnlI CCTC 3 cut(s) 36, 148, 220
MspR9I CCNGG 1 cut(s) 277
MvaI CCWGG 1 cut(s) 277
MvnI CGCG 1 cut(s) 268
MwoI GCNNNNNNNGC 2 cut(s) 214, 286
NdeII GATC 1 cut(s) 91
NlaIV GGNNCC 1 cut(s) 133
PceI AGGCCT 1 cut(s) 230
PciSI GCTCTTC 1 cut(s) 277
PflMI CCANNNNNTGG 1 cut(s) 316
Psp6I CCWGG 1 cut(s) 275
PspGI CCWGG 1 cut(s) 275
PspN4I GGNNCC 1 cut(s) 133
PspPI GGNCC 1 cut(s) 132
SapI GCTCTTC 1 cut(s) 277
Sau3AI GATC 1 cut(s) 91
Sau96I GGNCC 1 cut(s) 132
ScrFI CCNGG 1 cut(s) 277
SetI ASST 1 cut(s) 163
SinI GGWCC 1 cut(s) 132
Sse9I AATT 1 cut(s) 262
SseBI AGGCCT 1 cut(s) 230
SspMI CTAG 1 cut(s) 224
StuI AGGCCT 1 cut(s) 230
StyD4I CCNGG 1 cut(s) 275
TaqI TCGA 1 cut(s) 351
TasI AATT 1 cut(s) 262
TscAI CASTG 2 cut(s) 321, 330
TspRI CASTG 2 cut(s) 321, 330
Van91I CCANNNNNTGG 1 cut(s) 316
VpaK11BI GGWCC 1 cut(s) 132
XspI CTAG 1 cut(s) 224
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.