Rorug04G0006300

Cation transport protein

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000004
Physical Location & Seq
Reverse (-)
1110100 .. 1111833
1734 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug04G0006300.1

Sequence Viewer

Length: 189 bp
ATGGTATCGTCCGAGGTGATCTATGCTGTCATAAGCCCCGTTTTGGGAGTCCTGCTTGTTGGGTACTTTGCAAAGGTCACGCCTATCGCTCAAGACATGCTAAAAGACTGGAAAAGTAGCAACGAGGGCATACTGGAATCTTGCAGGGAGATCAGTAAAAGCTTGGGTGACTCTAAGGTTCAGAAATGA

Protein Analysis

62

Amino Acids

6.76

Weight (kDa)

6.11

Isoelectric Point (pI)

44.38

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 65
AfiI CCNNNNNNNGG 2 cut(s) 43, 44
AluBI AGCT 1 cut(s) 162
AluI AGCT 1 cut(s) 162
AsuHPI GGTGA 2 cut(s) 28, 179
BpuEI CTTGAG 1 cut(s) 75
BsaJI CCNNGG 1 cut(s) 12
Bsc4I CCNNNNNNNGG 2 cut(s) 43, 44
Bse1I ACTGG 2 cut(s) 113, 138
BseDI CCNNGG 1 cut(s) 12
BseLI CCNNNNNNNGG 2 cut(s) 43, 44
BseNI ACTGG 2 cut(s) 113, 138
BslI CCNNNNNNNGG 2 cut(s) 43, 44
Bsp143I GATC 2 cut(s) 18, 150
BsrI ACTGG 2 cut(s) 113, 138
BssECI CCNNGG 1 cut(s) 12
BssMI GATC 2 cut(s) 18, 150
BstDEI CTNAG 1 cut(s) 174
BstKTI GATC 2 cut(s) 21, 153
BstMBI GATC 2 cut(s) 18, 150
BstMWI GCNNNNNNNGC 1 cut(s) 126
BstNSI RCATGY 1 cut(s) 100
Csp6I GTAC 1 cut(s) 64
CviAII CATG 1 cut(s) 97
CviJI RGCY 2 cut(s) 36, 162
CviKI_1 RGCY 2 cut(s) 36, 162
CviQI GTAC 1 cut(s) 64
DdeI CTNAG 1 cut(s) 174
DpnI GATC 2 cut(s) 20, 152
DpnII GATC 2 cut(s) 18, 150
FaeI CATG 1 cut(s) 100
FaiI YATR 4 cut(s) 24, 32, 98, 131
FatI CATG 1 cut(s) 96
Hin1II CATG 1 cut(s) 100
HindIII AAGCTT 1 cut(s) 160
HinfI GANTC 3 cut(s) 48, 137, 170
HphI GGTGA 2 cut(s) 28, 179
Hpy188I TCNGA 2 cut(s) 13, 183
Hpy188III TCNNGA 1 cut(s) 92
HpyCH4V TGCA 2 cut(s) 71, 144
HpyF10VI GCNNNNNNNGC 1 cut(s) 126
HpyF3I CTNAG 1 cut(s) 174
Hsp92II CATG 1 cut(s) 100
Kzo9I GATC 2 cut(s) 18, 150
LpnPI CCDG 4 cut(s) 65, 94, 119, 130
MaeIII GTNAC 2 cut(s) 76, 167
MalI GATC 2 cut(s) 20, 152
MboI GATC 2 cut(s) 18, 150
MlyI GAGTC 2 cut(s) 57, 164
MnlI CCTC 2 cut(s) 7, 118
MwoI GCNNNNNNNGC 1 cut(s) 126
NdeII GATC 2 cut(s) 18, 150
NlaIII CATG 1 cut(s) 100
NmuCI GTSAC 2 cut(s) 76, 167
NspI RCATGY 1 cut(s) 100
PfeI GAWTC 1 cut(s) 137
PleI GAGTC 2 cut(s) 56, 164
PpsI GAGTC 2 cut(s) 56, 164
RsaI GTAC 1 cut(s) 65
RsaNI GTAC 1 cut(s) 64
Sau3AI GATC 2 cut(s) 18, 150
SchI GAGTC 2 cut(s) 57, 164
SetI ASST 4 cut(s) 18, 78, 164, 180
SmlI CTYRAG 1 cut(s) 90
SmoI CTYRAG 1 cut(s) 90
TfiI GAWTC 1 cut(s) 137
TseFI GTSAC 2 cut(s) 76, 167
Tsp45I GTSAC 2 cut(s) 76, 167
XceI RCATGY 1 cut(s) 100
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.