Rorug05G0430800
ERF Family

Belongs to the protein kinase superfamily. Ser Thr protein kinase family

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000005
Physical Location & Seq
Forward (+)
59880831 .. 59882376
1546 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug05G0430800.1

Sequence Viewer

Length: 381 bp
ATGAATTCGATGTTGAAACGTGGAGAAAGAGTGCGCGAAGATAGGATCAGTGAATTACCAAAAGCACTTGTTTGTCACATACGCTCCTTCATTCCGACAATAGAGGCTGTGAGGACTACTGTTTTGTCTAAGAGATGGAACGACATGTGGACTTCTGTCACCAGTCTAGACTTCGACGATGACAGAGAAAGTTCACCAGTACTGTATGACTGTAGTCATTTTACCAAGTTTGTTAATCGTGTACTTTTCTTTCGCAACTCATCAGACATACAACTTAGAATTCGGTATTTGTCTGACGCGGATTGTGTTGAAGATTGGATTTGCACTGCGGTTAGGCGCAATGTTGTAGAACTTTATATATACTTCACATGTGCAGACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

126

Amino Acids

14.91

Weight (kDa)

6.12

Isoelectric Point (pI)

53.66

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 2 cut(s) 36, 299
AciI CCGC 2 cut(s) 299, 329
AclWI GGATC 1 cut(s) 53
AcsI RAATTY 2 cut(s) 4, 279
AfaI GTAC 2 cut(s) 201, 243
AflIII ACRYGT 2 cut(s) 144, 368
AgsI TTSAA 2 cut(s) 16, 311
AlwI GGATC 1 cut(s) 53
ApoI RAATTY 2 cut(s) 4, 279
ArsI GACNNNNNNTTYG 2 cut(s) 106, 138
AspLEI GCGC 2 cut(s) 36, 339
AsuHPI GGTGA 2 cut(s) 151, 186
BccI CCATC 1 cut(s) 129
BfaI CTAG 2 cut(s) 167, 379
BfmI CTRYAG 1 cut(s) 211
BmcAI AGTACT 1 cut(s) 201
BoxI GACNNNNGTC 2 cut(s) 155, 213
BsaXI ACNNNNNCTCC 4 cut(s) 15, 45, 68, 98
Bse1I ACTGG 2 cut(s) 162, 197
Bse3DI GCAATG 1 cut(s) 346
BseMI GCAATG 1 cut(s) 346
BseNI ACTGG 2 cut(s) 162, 197
Bsh1236I CGCG 2 cut(s) 36, 299
Bsp143I GATC 1 cut(s) 45
BspACI CCGC 2 cut(s) 299, 329
BspFNI CGCG 2 cut(s) 36, 299
BspPI GGATC 1 cut(s) 53
BsrDI GCAATG 1 cut(s) 346
BsrI ACTGG 2 cut(s) 162, 197
BssMI GATC 1 cut(s) 45
Bst4CI ACNGT 3 cut(s) 121, 204, 212
BstDEI CTNAG 2 cut(s) 129, 275
BstFNI CGCG 2 cut(s) 36, 299
BstHHI GCGC 2 cut(s) 36, 339
BstKTI GATC 1 cut(s) 48
BstMBI GATC 1 cut(s) 45
BstNSI RCATGY 2 cut(s) 148, 372
BstPAI GACNNNNGTC 2 cut(s) 155, 213
BstSFI CTRYAG 1 cut(s) 211
BstUI CGCG 2 cut(s) 36, 299
BtsI GCAGTG 1 cut(s) 324
BtsIMutI CAGTG 2 cut(s) 55, 324
CfoI GCGC 2 cut(s) 36, 339
CseI GACGC 1 cut(s) 305
Csp6I GTAC 2 cut(s) 200, 242
CviAII CATG 2 cut(s) 145, 369
CviJI RGCY 1 cut(s) 107
CviKI_1 RGCY 1 cut(s) 107
CviQI GTAC 2 cut(s) 200, 242
DdeI CTNAG 2 cut(s) 129, 275
DpnI GATC 1 cut(s) 47
DpnII GATC 1 cut(s) 45
EcoRI GAATTC 2 cut(s) 4, 279
FaeI CATG 2 cut(s) 148, 372
FaiI YATR 8 cut(s) 80, 146, 207, 269, 357, 359, 361, 370
FatI CATG 2 cut(s) 144, 368
FspBI CTAG 2 cut(s) 167, 379
GlaI GCGC 2 cut(s) 35, 338
HgaI GACGC 1 cut(s) 305
HhaI GCGC 2 cut(s) 36, 339
Hin1II CATG 2 cut(s) 148, 372
Hin6I GCGC 2 cut(s) 34, 337
HinP1I GCGC 2 cut(s) 34, 337
HphI GGTGA 2 cut(s) 151, 186
Hpy166II GTNNAC 3 cut(s) 150, 194, 242
Hpy188I TCNGA 3 cut(s) 96, 265, 295
Hpy188III TCNNGA 1 cut(s) 167
Hpy8I GTNNAC 3 cut(s) 150, 194, 242
Hpy99I CGWCG 1 cut(s) 179
HpyAV CCTTC 1 cut(s) 97
HpyCH4III ACNGT 3 cut(s) 121, 204, 212
HpyCH4IV ACGT 1 cut(s) 19
HpyCH4V TGCA 2 cut(s) 324, 374
HpyF3I CTNAG 2 cut(s) 129, 275
HpySE526I ACGT 1 cut(s) 19
Hsp92II CATG 2 cut(s) 148, 372
HspAI GCGC 2 cut(s) 34, 337
Kzo9I GATC 1 cut(s) 45
LmnI GCTCC 1 cut(s) 89
LpnPI CCDG 2 cut(s) 175, 210
MaeI CTAG 2 cut(s) 167, 379
MaeII ACGT 1 cut(s) 19
MaeIII GTNAC 2 cut(s) 74, 157
MalI GATC 1 cut(s) 47
MboI GATC 1 cut(s) 45
MboII GAAGA 2 cut(s) 50, 323
MluCI AATT 3 cut(s) 4, 53, 279
MmeI TCCRAC 1 cut(s) 119
MnlI CCTC 2 cut(s) 97, 105
MseI TTAA 1 cut(s) 234
MvnI CGCG 2 cut(s) 36, 299
NdeII GATC 1 cut(s) 45
NlaIII CATG 2 cut(s) 148, 372
NmuCI GTSAC 2 cut(s) 74, 157
NspI RCATGY 2 cut(s) 148, 372
PciI ACATGT 2 cut(s) 144, 368
PscI ACATGT 2 cut(s) 144, 368
PshAI GACNNNNGTC 2 cut(s) 155, 213
RsaI GTAC 2 cut(s) 201, 243
RsaNI GTAC 2 cut(s) 200, 242
SaqAI TTAA 1 cut(s) 234
Sau3AI GATC 1 cut(s) 45
ScaI AGTACT 1 cut(s) 201
SetI ASST 1 cut(s) 22
SfcI CTRYAG 1 cut(s) 211
Sse9I AATT 3 cut(s) 4, 53, 279
SsiI CCGC 2 cut(s) 299, 329
SspMI CTAG 2 cut(s) 167, 379
TaaI ACNGT 3 cut(s) 121, 204, 212
TaiI ACGT 1 cut(s) 22
TaqI TCGA 2 cut(s) 8, 174
TasI AATT 3 cut(s) 4, 53, 279
TatI WGTACW 2 cut(s) 199, 241
Tru1I TTAA 1 cut(s) 234
Tru9I TTAA 1 cut(s) 234
TscAI CASTG 2 cut(s) 55, 331
TseFI GTSAC 2 cut(s) 74, 157
Tsp45I GTSAC 2 cut(s) 74, 157
TspDTI ATGAA 2 cut(s) 17, 79
TspRI CASTG 2 cut(s) 55, 331
XapI RAATTY 2 cut(s) 4, 279
XbaI TCTAGA 1 cut(s) 166
XceI RCATGY 2 cut(s) 148, 372
XspI CTAG 2 cut(s) 167, 379
ZrmI AGTACT 1 cut(s) 201
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.