Rorug07G0273800
MYB Family

SWI SNF complex subunit

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000007
Physical Location & Seq
Reverse (-)
25988985 .. 25991786
2802 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug07G0273800.1

Sequence Viewer

Length: 270 bp
ATGACTCGGGGAAAGCAGAAGATCGAAGCGCAGAGACGAAATGCGGAGAGGAATCAGAAGCCAAAAGGGTCTCAGTTTGAGGCCAGAGCCGTTGCTCTCAAAATCAGCTGTCCAATCTGCAAGGAGTTAATTACCCAAAACCTCGTTGGAAGAGGTCCAGGATACACGATGTACTTGAGAAAATGGGCGCAACTTGCAAACGCAAAGCAACTTGCTGATCACTATGCTTCCAAACATCCCAGAGAACAGCCTCCAGCTGAACCAGAATGA

Protein Analysis

89

Amino Acids

10.13

Weight (kDa)

10.01

Isoelectric Point (pI)

45.47

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 44
AfaI GTAC 1 cut(s) 173
AjnI CCWGG 1 cut(s) 157
AluBI AGCT 2 cut(s) 108, 257
AluI AGCT 2 cut(s) 108, 257
Alw26I GTCTC 2 cut(s) 28, 75
Ama87I CYCGRG 1 cut(s) 6
AoxI GGCC 1 cut(s) 81
AspLEI GCGC 2 cut(s) 31, 190
AspS9I GGNCC 1 cut(s) 155
AvaI CYCGRG 1 cut(s) 6
AvaII GGWCC 1 cut(s) 155
BceAI ACGGC 1 cut(s) 74
BciT130I CCWGG 1 cut(s) 159
BciVI GTATCC 1 cut(s) 155
BclI TGATCA 1 cut(s) 217
BcoDI GTCTC 2 cut(s) 28, 75
BfuI GTATCC 1 cut(s) 155
Bme1390I CCNGG 1 cut(s) 159
Bme18I GGWCC 1 cut(s) 155
BmeT110I CYCGRG 1 cut(s) 6
BmgT120I GGNCC 1 cut(s) 155
BmrFI CCNGG 1 cut(s) 159
BpmI CTGGAG 1 cut(s) 237
BpuEI CTTGAG 1 cut(s) 196
BsaI GGTCTC 1 cut(s) 75
BseBI CCWGG 1 cut(s) 159
BseGI GGATG 1 cut(s) 235
BseMII CTCAG 1 cut(s) 86
BshFI GGCC 1 cut(s) 83
BsiHKCI CYCGRG 1 cut(s) 6
BsmAI GTCTC 2 cut(s) 28, 75
BsmBI CGTCTC 1 cut(s) 28
BsnI GGCC 1 cut(s) 83
Bso31I GGTCTC 1 cut(s) 75
BsoBI CYCGRG 1 cut(s) 6
Bsp143I GATC 2 cut(s) 21, 217
BspACI CCGC 1 cut(s) 44
BspANI GGCC 1 cut(s) 83
BspCNI CTCAG 1 cut(s) 85
BspTNI GGTCTC 1 cut(s) 75
BssMI GATC 2 cut(s) 21, 217
Bst2UI CCWGG 1 cut(s) 159
Bst6I CTCTTC 1 cut(s) 145
BstDEI CTNAG 1 cut(s) 72
BstF5I GGATG 1 cut(s) 235
BstHHI GCGC 2 cut(s) 31, 190
BstKTI GATC 2 cut(s) 24, 220
BstMAI GTCTC 2 cut(s) 28, 75
BstMBI GATC 2 cut(s) 21, 217
BstMWI GCNNNNNNNGC 1 cut(s) 194
BstNI CCWGG 1 cut(s) 159
BstSCI CCNGG 1 cut(s) 157
BsuI GTATCC 1 cut(s) 155
BsuRI GGCC 1 cut(s) 83
BtsCI GGATG 1 cut(s) 235
CfoI GCGC 2 cut(s) 31, 190
Cfr13I GGNCC 1 cut(s) 155
Csp6I GTAC 1 cut(s) 172
CviJI RGCY 6 cut(s) 61, 83, 89, 108, 250, 257
CviKI_1 RGCY 6 cut(s) 61, 83, 89, 108, 250, 257
CviQI GTAC 1 cut(s) 172
DdeI CTNAG 1 cut(s) 72
DpnI GATC 2 cut(s) 23, 219
DpnII GATC 2 cut(s) 21, 217
Eam1104I CTCTTC 1 cut(s) 145
EarI CTCTTC 1 cut(s) 145
Eco31I GGTCTC 1 cut(s) 75
Eco47I GGWCC 1 cut(s) 155
Eco88I CYCGRG 1 cut(s) 6
EcoRII CCWGG 1 cut(s) 157
Esp3I CGTCTC 1 cut(s) 28
FaiI YATR 1 cut(s) 225
FbaI TGATCA 1 cut(s) 217
FokI GGATG 1 cut(s) 222
GlaI GCGC 2 cut(s) 30, 189
GsuI CTGGAG 1 cut(s) 237
HaeIII GGCC 1 cut(s) 83
HhaI GCGC 2 cut(s) 31, 190
Hin6I GCGC 2 cut(s) 29, 188
HinP1I GCGC 2 cut(s) 29, 188
HinfI GANTC 2 cut(s) 4, 52
Hpy188I TCNGA 1 cut(s) 57
HpyCH4V TGCA 2 cut(s) 120, 197
HpyF10VI GCNNNNNNNGC 1 cut(s) 194
HpyF3I CTNAG 1 cut(s) 72
HspAI GCGC 2 cut(s) 29, 188
Ksp22I TGATCA 1 cut(s) 217
Kzo9I GATC 2 cut(s) 21, 217
LpnPI CCDG 4 cut(s) 97, 144, 171, 253
MalI GATC 2 cut(s) 23, 219
MboI GATC 2 cut(s) 21, 217
MboII GAAGA 2 cut(s) 31, 162
MluCI AATT 1 cut(s) 129
MmeI TCCRAC 1 cut(s) 127
MnlI CCTC 5 cut(s) 42, 73, 146, 152, 261
MseI TTAA 1 cut(s) 128
MspA1I CMGCKG 2 cut(s) 108, 257
MspR9I CCNGG 1 cut(s) 159
MvaI CCWGG 1 cut(s) 159
MwoI GCNNNNNNNGC 1 cut(s) 194
NdeII GATC 2 cut(s) 21, 217
PfeI GAWTC 1 cut(s) 52
PfoI TCCNGGA 1 cut(s) 157
Psp6I CCWGG 1 cut(s) 157
PspGI CCWGG 1 cut(s) 157
PspPI GGNCC 1 cut(s) 155
PvuII CAGCTG 2 cut(s) 108, 257
RsaI GTAC 1 cut(s) 173
RsaNI GTAC 1 cut(s) 172
SaqAI TTAA 1 cut(s) 128
Sau3AI GATC 2 cut(s) 21, 217
Sau96I GGNCC 1 cut(s) 155
ScrFI CCNGG 1 cut(s) 159
SetI ASST 4 cut(s) 110, 144, 157, 259
SinI GGWCC 1 cut(s) 155
SmlI CTYRAG 1 cut(s) 175
SmoI CTYRAG 1 cut(s) 175
Sse9I AATT 1 cut(s) 129
SsiI CCGC 1 cut(s) 44
StyD4I CCNGG 1 cut(s) 157
TaqI TCGA 1 cut(s) 24
TasI AATT 1 cut(s) 129
TatI WGTACW 1 cut(s) 171
TfiI GAWTC 1 cut(s) 52
Tru1I TTAA 1 cut(s) 128
Tru9I TTAA 1 cut(s) 128
VpaK11BI GGWCC 1 cut(s) 155
XcmI CCANNNNNNNNNTGG 1 cut(s) 143
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.