Rh2AG329800

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
Physical Location & Seq
Reverse (-)
47443313 .. 47447678
4366 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG329800.1

Sequence Viewer

Length: 150 bp
ATGAGATCAGACACCATCTCAACCGGAGAGTGGGTTGGTCTCTGGACAAGGCTCGACGAGATCGAATATCAGCTGCTATTCACCAACAAAGGGATGGAGCTATCCCTGTTCTCACTTTGGCAATTGAAGGAAACCTCCTTAAAGGTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

49

Amino Acids

5.79

Weight (kDa)

4.77

Isoelectric Point (pI)

18.68

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 2 cut(s) 30, 90
AgsI TTSAA 1 cut(s) 127
AluBI AGCT 2 cut(s) 73, 100
AluI AGCT 2 cut(s) 73, 100
Alw26I GTCTC 1 cut(s) 44
ApeKI GCWGC 1 cut(s) 73
AsuHPI GGTGA 1 cut(s) 73
BbvI GCAGC 1 cut(s) 60
BccI CCATC 2 cut(s) 23, 88
BcoDI GTCTC 1 cut(s) 44
BisI GCNGC 1 cut(s) 74
BlsI GCNGC 1 cut(s) 75
BsaI GGTCTC 1 cut(s) 44
BsaWI WCCGGW 1 cut(s) 23
BsaXI ACNNNNNCTCC 2 cut(s) 18, 48
Bsc4I CCNNNNNNNGG 2 cut(s) 30, 90
BseGI GGATG 1 cut(s) 99
BseLI CCNNNNNNNGG 2 cut(s) 30, 90
BseXI GCAGC 1 cut(s) 60
BsiSI CCGG 1 cut(s) 24
BslI CCNNNNNNNGG 2 cut(s) 30, 90
BsmAI GTCTC 1 cut(s) 44
Bso31I GGTCTC 1 cut(s) 44
Bsp143I GATC 2 cut(s) 5, 60
BspTNI GGTCTC 1 cut(s) 44
BssMI GATC 2 cut(s) 5, 60
BstF5I GGATG 1 cut(s) 99
BstKTI GATC 2 cut(s) 8, 63
BstMAI GTCTC 1 cut(s) 44
BstMBI GATC 2 cut(s) 5, 60
BstV1I GCAGC 1 cut(s) 60
BtsCI GGATG 1 cut(s) 99
CviJI RGCY 3 cut(s) 52, 73, 100
CviKI_1 RGCY 3 cut(s) 52, 73, 100
DpnI GATC 2 cut(s) 7, 62
DpnII GATC 2 cut(s) 5, 60
Eco31I GGTCTC 1 cut(s) 44
Fnu4HI GCNGC 1 cut(s) 74
FokI GGATG 1 cut(s) 106
Fsp4HI GCNGC 1 cut(s) 74
GluI GCNGC 1 cut(s) 74
HapII CCGG 1 cut(s) 24
HpaII CCGG 1 cut(s) 24
HphI GGTGA 1 cut(s) 73
Hpy188I TCNGA 1 cut(s) 10
Hpy188III TCNNGA 1 cut(s) 43
Hpy99I CGWCG 1 cut(s) 59
HpyAV CCTTC 1 cut(s) 121
Kzo9I GATC 2 cut(s) 5, 60
LmnI GCTCC 1 cut(s) 97
LpnPI CCDG 3 cut(s) 28, 37, 119
Lsp1109I GCAGC 1 cut(s) 60
MalI GATC 2 cut(s) 7, 62
MboI GATC 2 cut(s) 5, 60
MfeI CAATTG 1 cut(s) 122
MluCI AATT 1 cut(s) 122
MnlI CCTC 1 cut(s) 145
MseI TTAA 1 cut(s) 140
MspA1I CMGCKG 1 cut(s) 73
MspI CCGG 1 cut(s) 24
MunI CAATTG 1 cut(s) 122
NdeII GATC 2 cut(s) 5, 60
PcsI WCGNNNNNNNCGW 1 cut(s) 60
PkrI GCNGC 1 cut(s) 75
PvuII CAGCTG 1 cut(s) 73
SaqAI TTAA 1 cut(s) 140
SatI GCNGC 1 cut(s) 74
Sau3AI GATC 2 cut(s) 5, 60
SetI ASST 4 cut(s) 75, 102, 137, 147
SgeI CNNG 6 cut(s) 36, 55, 60, 65, 70, 118
Sse9I AATT 1 cut(s) 122
TaqI TCGA 2 cut(s) 54, 63
TasI AATT 1 cut(s) 122
Tru1I TTAA 1 cut(s) 140
Tru9I TTAA 1 cut(s) 140
TseI GCWGC 1 cut(s) 73
XcmI CCANNNNNNNNNTGG 1 cut(s) 91
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.