Rh1AG134200

Protein arv1 homolog

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1A
OG0001502
Physical Location & Seq
Forward (+)
25671770 .. 25674529
2760 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1AG134200.1

Sequence Viewer

Length: 483 bp
ATGTTGCAGATGACTAGTACTAGAGTCCGAGCCCATAGAGTCTCTTACTGGAAAGGGTGGAGGAAAAATGGGATGCTGATGGATGTTGTATTCGGAAGTTTCATGTGTCTATCTACCTTTCTGCTTGCTACGAGGGCTCTTTTCAGCACATTCCCTAGATCACTCGGGTACAAAGACCTTCTGCTGGCACTACTTATTTACTTCAAGATGTTTCTAATTGCAATGATGGTCTGGGAATGTCCTATGATTGTGATCATTGATTTATTTGTGTTATCCTCCCACACAGTGGCACTCAAAGTTCATGGCTTGGATGACTCTGGTGGGGTGATGAAGCATCTCATCATGTCTTGGAATGACAAAAGACCCAACAGGCCTTCTCAGAAATGGATTAAGCAAAGCATCTCATCATGTCTTGGAATGACAAAAGACCCAACAGGCCTTCTCAGAAATGGATTAAGCAAAGGCATAGAGTCAGGCAAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Arv1

Protein Analysis

160

Amino Acids

18.19

Weight (kDa)

10.07

Isoelectric Point (pI)

41.14

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 286
AdeI CACNNNGTG 1 cut(s) 286
AfaI GTAC 2 cut(s) 19, 170
AfiI CCNNNNNNNGG 2 cut(s) 184, 286
AgsI TTSAA 1 cut(s) 205
AhlI ACTAGT 1 cut(s) 14
Alw26I GTCTC 1 cut(s) 46
Ama87I CYCGRG 1 cut(s) 164
AoxI GGCC 2 cut(s) 371, 436
AsuHPI GGTGA 1 cut(s) 337
AvaI CYCGRG 1 cut(s) 164
BanII GRGCYC 2 cut(s) 34, 139
BccI CCATC 2 cut(s) 73, 220
BclI TGATCA 1 cut(s) 252
BcoDI GTCTC 1 cut(s) 46
BcuI ACTAGT 1 cut(s) 14
BfaI CTAG 3 cut(s) 15, 21, 156
BmcAI AGTACT 1 cut(s) 19
BmeT110I CYCGRG 1 cut(s) 164
BmsI GCATC 3 cut(s) 63, 343, 408
BsaBI GATNNNNATC 1 cut(s) 251
Bsc4I CCNNNNNNNGG 2 cut(s) 184, 286
Bse1I ACTGG 1 cut(s) 53
Bse3DI GCAATG 1 cut(s) 228
Bse8I GATNNNNATC 1 cut(s) 251
BseGI GGATG 3 cut(s) 78, 88, 316
BseJI GATNNNNATC 1 cut(s) 251
BseLI CCNNNNNNNGG 2 cut(s) 184, 286
BseMI GCAATG 1 cut(s) 228
BseMII CTCAG 2 cut(s) 392, 457
BseNI ACTGG 1 cut(s) 53
BshFI GGCC 2 cut(s) 373, 438
BsiHKCI CYCGRG 1 cut(s) 164
BslI CCNNNNNNNGG 2 cut(s) 184, 286
BsmAI GTCTC 1 cut(s) 46
BsnI GGCC 2 cut(s) 373, 438
BsoBI CYCGRG 1 cut(s) 164
Bsp1286I GDGCHC 2 cut(s) 34, 139
Bsp143I GATC 2 cut(s) 158, 252
BspANI GGCC 2 cut(s) 373, 438
BspCNI CTCAG 2 cut(s) 391, 456
BsrDI GCAATG 1 cut(s) 228
BsrI ACTGG 1 cut(s) 53
BssMI GATC 2 cut(s) 158, 252
Bst4CI ACNGT 1 cut(s) 286
BstC8I GCNNGC 2 cut(s) 126, 186
BstDEI CTNAG 2 cut(s) 378, 443
BstF5I GGATG 3 cut(s) 78, 88, 316
BstKTI GATC 2 cut(s) 161, 255
BstMAI GTCTC 1 cut(s) 46
BstMBI GATC 2 cut(s) 158, 252
BstMWI GCNNNNNNNGC 1 cut(s) 134
BsuRI GGCC 2 cut(s) 373, 438
BtsCI GGATG 3 cut(s) 78, 88, 316
BtsIMutI CAGTG 1 cut(s) 291
Cac8I GCNNGC 2 cut(s) 126, 186
Csp6I GTAC 2 cut(s) 18, 169
CviAII CATG 4 cut(s) 103, 302, 343, 408
CviJI RGCY 5 cut(s) 32, 137, 306, 373, 438
CviKI_1 RGCY 5 cut(s) 32, 137, 306, 373, 438
CviQI GTAC 2 cut(s) 18, 169
DdeI CTNAG 2 cut(s) 378, 443
DpnI GATC 2 cut(s) 160, 254
DpnII GATC 2 cut(s) 158, 252
DraIII CACNNNGTG 1 cut(s) 286
Eco147I AGGCCT 2 cut(s) 373, 438
Eco24I GRGCYC 2 cut(s) 34, 139
Eco88I CYCGRG 1 cut(s) 164
EcoT38I GRGCYC 2 cut(s) 34, 139
FaeI CATG 4 cut(s) 106, 305, 346, 411
FaiI YATR 7 cut(s) 36, 104, 245, 303, 344, 409, 467
FatI CATG 4 cut(s) 102, 301, 342, 407
FbaI TGATCA 1 cut(s) 252
FokI GGATG 3 cut(s) 85, 95, 323
FriOI GRGCYC 2 cut(s) 34, 139
FspBI CTAG 3 cut(s) 15, 21, 156
HaeIII GGCC 2 cut(s) 373, 438
Hin1II CATG 4 cut(s) 106, 305, 346, 411
HinfI GANTC 4 cut(s) 24, 39, 314, 470
HphI GGTGA 1 cut(s) 337
Hpy188I TCNGA 4 cut(s) 29, 95, 381, 446
Hpy188III TCNNGA 1 cut(s) 205
HpyAV CCTTC 3 cut(s) 188, 384, 449
HpyCH4III ACNGT 1 cut(s) 286
HpyCH4V TGCA 2 cut(s) 7, 221
HpyF10VI GCNNNNNNNGC 1 cut(s) 134
HpyF3I CTNAG 2 cut(s) 378, 443
Hsp92II CATG 4 cut(s) 106, 305, 346, 411
Ksp22I TGATCA 1 cut(s) 252
Kzo9I GATC 2 cut(s) 158, 252
LpnPI CCDG 7 cut(s) 34, 170, 217, 303, 355, 420, 459
LweI GCATC 3 cut(s) 63, 343, 408
MaeI CTAG 3 cut(s) 15, 21, 156
MalI GATC 2 cut(s) 160, 254
MboI GATC 2 cut(s) 158, 252
MhlI GDGCHC 2 cut(s) 34, 139
MluCI AATT 1 cut(s) 216
MlyI GAGTC 4 cut(s) 33, 48, 308, 479
MnlI CCTC 3 cut(s) 54, 126, 286
MseI TTAA 2 cut(s) 390, 455
MwoI GCNNNNNNNGC 1 cut(s) 134
NdeII GATC 2 cut(s) 158, 252
NlaIII CATG 4 cut(s) 106, 305, 346, 411
PceI AGGCCT 2 cut(s) 373, 438
PflMI CCANNNNNTGG 1 cut(s) 286
PleI GAGTC 4 cut(s) 32, 47, 308, 478
PpsI GAGTC 4 cut(s) 32, 47, 308, 478
RsaI GTAC 2 cut(s) 19, 170
RsaNI GTAC 2 cut(s) 18, 169
SaqAI TTAA 2 cut(s) 390, 455
Sau3AI GATC 2 cut(s) 158, 252
ScaI AGTACT 1 cut(s) 19
SchI GAGTC 4 cut(s) 33, 48, 308, 479
SduI GDGCHC 2 cut(s) 34, 139
SetI ASST 2 cut(s) 119, 180
SfaNI GCATC 3 cut(s) 63, 343, 408
SpeI ACTAGT 1 cut(s) 14
Sse9I AATT 1 cut(s) 216
SseBI AGGCCT 2 cut(s) 373, 438
SspMI CTAG 3 cut(s) 15, 21, 156
StuI AGGCCT 2 cut(s) 373, 438
TaaI ACNGT 1 cut(s) 286
TasI AATT 1 cut(s) 216
TatI WGTACW 1 cut(s) 17
Tru1I TTAA 2 cut(s) 390, 455
Tru9I TTAA 2 cut(s) 390, 455
TscAI CASTG 1 cut(s) 291
TspDTI ATGAA 3 cut(s) 91, 290, 344
TspRI CASTG 1 cut(s) 291
Van91I CCANNNNNTGG 1 cut(s) 286
XspI CTAG 3 cut(s) 15, 21, 156
ZrmI AGTACT 1 cut(s) 19
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.