Rh1DG042900

Belongs to the mitochondrial carrier (TC 2.A.29) family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1D
Physical Location & Seq
Forward (+)
6846626 .. 6848238
1613 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1DG042900.1

Sequence Viewer

Length: 228 bp
ATGCTCGGCAAGAAGTTCATCAAAGCTTACATTCCAGGAATCACAGTTGCGAATTTTGGCCAGACCAGGAATGAATGTTTAAAGGGTCCTCTGGCCTTTTATAAGGGCTTCATCCCAAATTTTGGACGGCTAGGATCTTGGAATGTGATCATGTTTCTAACCCTTGAGCAGATTTCCCACCTACGGCATCGGAAGCCATTGGTGAGACACCAGGCTTCTTATTTCTAG

Protein Analysis

75

Amino Acids

8.67

Weight (kDa)

10.51

Isoelectric Point (pI)

23.63

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 102
AccB7I CCANNNNNTGG 1 cut(s) 122
AclWI GGATC 1 cut(s) 142
AcoI YGGCCR 1 cut(s) 58
AcsI RAATTY 2 cut(s) 52, 118
AfiI CCNNNNNNNGG 2 cut(s) 122, 183
AjnI CCWGG 3 cut(s) 34, 65, 210
AluBI AGCT 1 cut(s) 26
AluI AGCT 1 cut(s) 26
Alw26I GTCTC 1 cut(s) 199
AlwI GGATC 1 cut(s) 142
AoxI GGCC 2 cut(s) 58, 93
ApoI RAATTY 2 cut(s) 52, 118
AspS9I GGNCC 1 cut(s) 86
AsuHPI GGTGA 1 cut(s) 214
AvaII GGWCC 1 cut(s) 86
BalI TGGCCA 1 cut(s) 60
BceAI ACGGC 2 cut(s) 143, 200
BciT130I CCWGG 3 cut(s) 36, 67, 212
BclI TGATCA 1 cut(s) 147
BcoDI GTCTC 1 cut(s) 199
BfaI CTAG 2 cut(s) 131, 226
Bme1390I CCNGG 3 cut(s) 36, 67, 212
Bme18I GGWCC 1 cut(s) 86
BmgT120I GGNCC 1 cut(s) 86
BmiI GGNNCC 1 cut(s) 87
BmrFI CCNGG 3 cut(s) 36, 67, 212
BmsI GCATC 1 cut(s) 196
BpuEI CTTGAG 1 cut(s) 185
Bsc4I CCNNNNNNNGG 2 cut(s) 122, 183
BseBI CCWGG 3 cut(s) 36, 67, 212
BseGI GGATG 1 cut(s) 111
BseLI CCNNNNNNNGG 2 cut(s) 122, 183
BshFI GGCC 2 cut(s) 60, 95
BslI CCNNNNNNNGG 2 cut(s) 122, 183
BsmAI GTCTC 1 cut(s) 199
BsnI GGCC 2 cut(s) 60, 95
Bsp143I GATC 2 cut(s) 134, 147
BspANI GGCC 2 cut(s) 60, 95
BspLI GGNNCC 1 cut(s) 87
BspPI GGATC 1 cut(s) 142
BssMI GATC 2 cut(s) 134, 147
Bst2UI CCWGG 3 cut(s) 36, 67, 212
Bst4CI ACNGT 1 cut(s) 46
BstF5I GGATG 1 cut(s) 111
BstKTI GATC 2 cut(s) 137, 150
BstMAI GTCTC 1 cut(s) 199
BstMBI GATC 2 cut(s) 134, 147
BstMWI GCNNNNNNNGC 1 cut(s) 193
BstNI CCWGG 3 cut(s) 36, 67, 212
BstSCI CCNGG 3 cut(s) 34, 65, 210
BstX2I RGATCY 1 cut(s) 134
BstYI RGATCY 1 cut(s) 134
BsuRI GGCC 2 cut(s) 60, 95
BtsCI GGATG 1 cut(s) 111
Cfr13I GGNCC 1 cut(s) 86
CviAII CATG 1 cut(s) 151
CviJI RGCY 7 cut(s) 26, 60, 95, 108, 130, 196, 215
CviKI_1 RGCY 7 cut(s) 26, 60, 95, 108, 130, 196, 215
DpnI GATC 2 cut(s) 136, 149
DpnII GATC 2 cut(s) 134, 147
DraI TTTAAA 1 cut(s) 81
EaeI YGGCCR 1 cut(s) 58
Eco47I GGWCC 1 cut(s) 86
EcoO109I RGGNCCY 1 cut(s) 86
EcoRII CCWGG 3 cut(s) 34, 65, 210
FaeI CATG 1 cut(s) 154
FaiI YATR 2 cut(s) 102, 152
FatI CATG 1 cut(s) 150
FbaI TGATCA 1 cut(s) 147
FokI GGATG 1 cut(s) 98
FspBI CTAG 2 cut(s) 131, 226
HaeIII GGCC 2 cut(s) 60, 95
Hin1II CATG 1 cut(s) 154
HindIII AAGCTT 1 cut(s) 24
HinfI GANTC 1 cut(s) 39
HphI GGTGA 1 cut(s) 214
Hpy188I TCNGA 1 cut(s) 192
HpyCH4III ACNGT 1 cut(s) 46
HpyF10VI GCNNNNNNNGC 1 cut(s) 193
Hsp92II CATG 1 cut(s) 154
Ksp22I TGATCA 1 cut(s) 147
Kzo9I GATC 2 cut(s) 134, 147
LpnPI CCDG 8 cut(s) 21, 48, 52, 74, 77, 79, 197, 224
LweI GCATC 1 cut(s) 196
MaeI CTAG 2 cut(s) 131, 226
MalI GATC 2 cut(s) 136, 149
MboI GATC 2 cut(s) 134, 147
MflI RGATCY 1 cut(s) 134
MlsI TGGCCA 1 cut(s) 60
MluCI AATT 2 cut(s) 52, 118
MluNI TGGCCA 1 cut(s) 60
MnlI CCTC 1 cut(s) 99
Mox20I TGGCCA 1 cut(s) 60
MscI TGGCCA 1 cut(s) 60
MseI TTAA 1 cut(s) 80
Msp20I TGGCCA 1 cut(s) 60
MspR9I CCNGG 3 cut(s) 36, 67, 212
MvaI CCWGG 3 cut(s) 36, 67, 212
MwoI GCNNNNNNNGC 1 cut(s) 193
NdeII GATC 2 cut(s) 134, 147
NlaIII CATG 1 cut(s) 154
NlaIV GGNNCC 1 cut(s) 87
PfeI GAWTC 1 cut(s) 39
PflMI CCANNNNNTGG 1 cut(s) 122
PfoI TCCNGGA 1 cut(s) 34
PpuMI RGGWCCY 1 cut(s) 86
PsiI TTATAA 1 cut(s) 102
Psp5II RGGWCCY 1 cut(s) 86
Psp6I CCWGG 3 cut(s) 34, 65, 210
PspGI CCWGG 3 cut(s) 34, 65, 210
PspN4I GGNNCC 1 cut(s) 87
PspPI GGNCC 1 cut(s) 86
PspPPI RGGWCCY 1 cut(s) 86
PsuI RGATCY 1 cut(s) 134
SaqAI TTAA 1 cut(s) 80
Sau3AI GATC 2 cut(s) 134, 147
Sau96I GGNCC 1 cut(s) 86
ScrFI CCNGG 3 cut(s) 36, 67, 212
SetI ASST 2 cut(s) 28, 183
SfaNI GCATC 1 cut(s) 196
SinI GGWCC 1 cut(s) 86
SmlI CTYRAG 1 cut(s) 164
SmoI CTYRAG 1 cut(s) 164
Sse9I AATT 2 cut(s) 52, 118
SspMI CTAG 2 cut(s) 131, 226
StyD4I CCNGG 3 cut(s) 34, 65, 210
TaaI ACNGT 1 cut(s) 46
TasI AATT 2 cut(s) 52, 118
TfiI GAWTC 1 cut(s) 39
Tru1I TTAA 1 cut(s) 80
Tru9I TTAA 1 cut(s) 80
TspDTI ATGAA 3 cut(s) 7, 87, 100
Van91I CCANNNNNTGG 1 cut(s) 122
VpaK11BI GGWCC 1 cut(s) 86
XapI RAATTY 2 cut(s) 52, 118
XspI CTAG 2 cut(s) 131, 226
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.