Rw1G001560

No description available

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr1
Physical Location & Seq
Forward (+)
2745496 .. 2752419
6924 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw1G001560.1

Sequence Viewer

Length: 237 bp
ATGTTCAACTGCTTGCCCTTCCTCCTCACGGCTTCTCTAAACAACAAATCCTTCATCCTCGGCAAGAAGTTCGTCAAAGCTTACATTACAGGAATCACTGTTGCAAATTCTGCCCAGACAAAGAGTGAATGTTTAAAGATAATAGTAACAATGCGCACAGCAAGAATTCAAGATATCCAACCCTTAGAAAACGACCCCCAAATCAAAGTGCAGATCTACATATATGTCTATTCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

78

Amino Acids

8.86

Weight (kDa)

9.47

Isoelectric Point (pI)

28.3

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 155
AcsI RAATTY 2 cut(s) 106, 165
AfiI CCNNNNNNNGG 1 cut(s) 28
AgsI TTSAA 2 cut(s) 7, 170
AluBI AGCT 1 cut(s) 80
AluI AGCT 1 cut(s) 80
ApoI RAATTY 2 cut(s) 106, 165
AspLEI GCGC 1 cut(s) 156
BceAI ACGGC 1 cut(s) 45
BcgI CGANNNNNNTGC 2 cut(s) 52, 86
BglII AGATCT 1 cut(s) 213
BsaJI CCNNGG 1 cut(s) 58
Bsc4I CCNNNNNNNGG 1 cut(s) 28
BseDI CCNNGG 1 cut(s) 58
BseGI GGATG 1 cut(s) 54
BseLI CCNNNNNNNGG 1 cut(s) 28
BseRI GAGGAG 1 cut(s) 14
BsgI GTGCAG 1 cut(s) 230
BslI CCNNNNNNNGG 1 cut(s) 28
Bsp143I GATC 1 cut(s) 213
BspHI TCATGA 1 cut(s) 233
BssECI CCNNGG 1 cut(s) 58
BssMI GATC 1 cut(s) 213
Bst4CI ACNGT 1 cut(s) 100
BstAPI GCANNNNNTGC 1 cut(s) 110
BstC8I GCNNGC 1 cut(s) 14
BstDEI CTNAG 1 cut(s) 184
BstF5I GGATG 1 cut(s) 54
BstHHI GCGC 1 cut(s) 156
BstKTI GATC 1 cut(s) 216
BstMBI GATC 1 cut(s) 213
BstMWI GCNNNNNNNGC 1 cut(s) 110
BstX2I RGATCY 1 cut(s) 213
BstYI RGATCY 1 cut(s) 213
BtsCI GGATG 1 cut(s) 54
BtsIMutI CAGTG 1 cut(s) 96
Cac8I GCNNGC 1 cut(s) 14
CciI TCATGA 1 cut(s) 233
CfoI GCGC 1 cut(s) 156
CviAII CATG 1 cut(s) 234
CviJI RGCY 2 cut(s) 32, 80
CviKI_1 RGCY 2 cut(s) 32, 80
DdeI CTNAG 1 cut(s) 184
DpnI GATC 1 cut(s) 215
DpnII GATC 1 cut(s) 213
DraI TTTAAA 1 cut(s) 135
Eco32I GATATC 1 cut(s) 175
EcoRI GAATTC 1 cut(s) 165
EcoRV GATATC 1 cut(s) 175
FaeI CATG 1 cut(s) 237
FaiI YATR 4 cut(s) 221, 223, 225, 235
FatI CATG 1 cut(s) 233
FokI GGATG 1 cut(s) 41
FspAI RTGCGCAY 1 cut(s) 155
FspI TGCGCA 1 cut(s) 155
GlaI GCGC 1 cut(s) 155
HhaI GCGC 1 cut(s) 156
Hin1II CATG 1 cut(s) 237
Hin6I GCGC 1 cut(s) 154
HinP1I GCGC 1 cut(s) 154
HindIII AAGCTT 1 cut(s) 78
HinfI GANTC 1 cut(s) 93
Hpy188III TCNNGA 2 cut(s) 170, 234
HpyAV CCTTC 2 cut(s) 28, 61
HpyCH4III ACNGT 1 cut(s) 100
HpyCH4V TGCA 2 cut(s) 104, 211
HpyF10VI GCNNNNNNNGC 1 cut(s) 110
HpyF3I CTNAG 1 cut(s) 184
Hsp92II CATG 1 cut(s) 237
HspAI GCGC 1 cut(s) 154
Kzo9I GATC 1 cut(s) 213
LpnPI CCDG 2 cut(s) 75, 128
MaeIII GTNAC 1 cut(s) 145
MalI GATC 1 cut(s) 215
MboI GATC 1 cut(s) 213
MflI RGATCY 1 cut(s) 213
MluCI AATT 2 cut(s) 106, 165
MmeI TCCRAC 1 cut(s) 202
MnlI CCTC 3 cut(s) 32, 35, 68
MseI TTAA 1 cut(s) 134
MwoI GCNNNNNNNGC 1 cut(s) 110
NdeII GATC 1 cut(s) 213
NlaIII CATG 1 cut(s) 237
NmeAIII GCCGAG 1 cut(s) 39
NsbI TGCGCA 1 cut(s) 155
PagI TCATGA 1 cut(s) 233
PfeI GAWTC 1 cut(s) 93
PsuI RGATCY 1 cut(s) 213
SaqAI TTAA 1 cut(s) 134
Sau3AI GATC 1 cut(s) 213
SetI ASST 1 cut(s) 82
SgeI CNNG 8 cut(s) 25, 40, 71, 76, 102, 127, 174, 182
Sse9I AATT 2 cut(s) 106, 165
TaaI ACNGT 1 cut(s) 100
TasI AATT 2 cut(s) 106, 165
TfiI GAWTC 1 cut(s) 93
Tru1I TTAA 1 cut(s) 134
Tru9I TTAA 1 cut(s) 134
TscAI CASTG 1 cut(s) 103
TspDTI ATGAA 2 cut(s) 43, 222
TspRI CASTG 1 cut(s) 103
XapI RAATTY 2 cut(s) 106, 165
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.