Rh1DG043700

Belongs to the mitochondrial carrier (TC 2.A.29) family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1D
Physical Location & Seq
Forward (+)
6927722 .. 6929561
1840 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1DG043700.1

Sequence Viewer

Length: 225 bp
ATGCTCGGCAAGAAGTTCGTCAAAGCTTGCATTCCAGGATGTGATGCACCTCATGAGTTGGGTTTCAATTATGAGTATCCTGGACTTCTGGCCTTTTATAAGGGCTTCATCCCAAATTTTGGACGGCTAGGATATTGGAATGTGATCATGTTTATAACCCTTGAGCAGATTTCCCACCTACGGCATCAGAAGCCATTGGTGAGACACCAGGCTTCTTATTTCTAG

Protein Analysis

74

Amino Acids

8.62

Weight (kDa)

9.3

Isoelectric Point (pI)

29.08

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 2 cut(s) 99, 155
AccB7I CCANNNNNTGG 1 cut(s) 119
AcsI RAATTY 1 cut(s) 115
AfiI CCNNNNNNNGG 2 cut(s) 119, 180
AgsI TTSAA 1 cut(s) 67
AjnI CCWGG 3 cut(s) 34, 79, 207
AluBI AGCT 1 cut(s) 26
AluI AGCT 1 cut(s) 26
Alw26I GTCTC 1 cut(s) 196
AoxI GGCC 1 cut(s) 90
ApoI RAATTY 1 cut(s) 115
AsuHPI GGTGA 1 cut(s) 211
BceAI ACGGC 2 cut(s) 140, 197
BcgI CGANNNNNNTGC 1 cut(s) 32
BciT130I CCWGG 3 cut(s) 36, 81, 209
BciVI GTATCC 1 cut(s) 87
BclI TGATCA 1 cut(s) 144
BcoDI GTCTC 1 cut(s) 196
BfaI CTAG 2 cut(s) 128, 223
BfuI GTATCC 1 cut(s) 87
Bme1390I CCNGG 3 cut(s) 36, 81, 209
BmrFI CCNGG 3 cut(s) 36, 81, 209
BmsI GCATC 2 cut(s) 34, 193
BpuEI CTTGAG 1 cut(s) 182
Bsc4I CCNNNNNNNGG 2 cut(s) 119, 180
BseBI CCWGG 3 cut(s) 36, 81, 209
BseGI GGATG 2 cut(s) 44, 108
BseLI CCNNNNNNNGG 2 cut(s) 119, 180
BshFI GGCC 1 cut(s) 92
BslI CCNNNNNNNGG 2 cut(s) 119, 180
BsmAI GTCTC 1 cut(s) 196
BsmI GAATGC 1 cut(s) 30
BsnI GGCC 1 cut(s) 92
Bsp143I GATC 1 cut(s) 144
BspANI GGCC 1 cut(s) 92
BspHI TCATGA 1 cut(s) 52
BssMI GATC 1 cut(s) 144
Bst2UI CCWGG 3 cut(s) 36, 81, 209
BstC8I GCNNGC 1 cut(s) 28
BstF5I GGATG 2 cut(s) 44, 108
BstKTI GATC 1 cut(s) 147
BstMAI GTCTC 1 cut(s) 196
BstMBI GATC 1 cut(s) 144
BstMWI GCNNNNNNNGC 1 cut(s) 190
BstNI CCWGG 3 cut(s) 36, 81, 209
BstSCI CCNGG 3 cut(s) 34, 79, 207
BsuI GTATCC 1 cut(s) 87
BsuRI GGCC 1 cut(s) 92
BtsCI GGATG 2 cut(s) 44, 108
Cac8I GCNNGC 1 cut(s) 28
CciI TCATGA 1 cut(s) 52
CviAII CATG 2 cut(s) 53, 148
CviJI RGCY 6 cut(s) 26, 92, 105, 127, 193, 212
CviKI_1 RGCY 6 cut(s) 26, 92, 105, 127, 193, 212
DpnI GATC 1 cut(s) 146
DpnII GATC 1 cut(s) 144
EcoRII CCWGG 3 cut(s) 34, 79, 207
FaeI CATG 2 cut(s) 56, 151
FaiI YATR 5 cut(s) 54, 72, 99, 149, 155
FatI CATG 2 cut(s) 52, 147
FbaI TGATCA 1 cut(s) 144
FokI GGATG 2 cut(s) 51, 95
FspBI CTAG 2 cut(s) 128, 223
HaeIII GGCC 1 cut(s) 92
Hin1II CATG 2 cut(s) 56, 151
HindIII AAGCTT 1 cut(s) 24
HphI GGTGA 1 cut(s) 211
Hpy188I TCNGA 1 cut(s) 189
Hpy188III TCNNGA 1 cut(s) 53
HpyCH4V TGCA 2 cut(s) 30, 47
HpyF10VI GCNNNNNNNGC 1 cut(s) 190
Hsp92II CATG 2 cut(s) 56, 151
Ksp22I TGATCA 1 cut(s) 144
Kzo9I GATC 1 cut(s) 144
LpnPI CCDG 7 cut(s) 21, 48, 66, 74, 93, 194, 221
LweI GCATC 2 cut(s) 34, 193
MaeI CTAG 2 cut(s) 128, 223
MalI GATC 1 cut(s) 146
MboI GATC 1 cut(s) 144
MluCI AATT 2 cut(s) 67, 115
MnlI CCTC 1 cut(s) 60
MspR9I CCNGG 3 cut(s) 36, 81, 209
Mva1269I GAATGC 1 cut(s) 30
MvaI CCWGG 3 cut(s) 36, 81, 209
MwoI GCNNNNNNNGC 1 cut(s) 190
NdeII GATC 1 cut(s) 144
NlaIII CATG 2 cut(s) 56, 151
PagI TCATGA 1 cut(s) 52
PctI GAATGC 1 cut(s) 30
PflMI CCANNNNNTGG 1 cut(s) 119
PfoI TCCNGGA 2 cut(s) 34, 79
PsiI TTATAA 2 cut(s) 99, 155
Psp6I CCWGG 3 cut(s) 34, 79, 207
PspGI CCWGG 3 cut(s) 34, 79, 207
Sau3AI GATC 1 cut(s) 144
ScrFI CCNGG 3 cut(s) 36, 81, 209
SetI ASST 3 cut(s) 28, 52, 180
SfaNI GCATC 2 cut(s) 34, 193
SmlI CTYRAG 1 cut(s) 161
SmoI CTYRAG 1 cut(s) 161
Sse9I AATT 2 cut(s) 67, 115
SspMI CTAG 2 cut(s) 128, 223
StyD4I CCNGG 3 cut(s) 34, 79, 207
TasI AATT 2 cut(s) 67, 115
TspDTI ATGAA 1 cut(s) 97
Van91I CCANNNNNTGG 1 cut(s) 119
XapI RAATTY 1 cut(s) 115
XspI CTAG 2 cut(s) 128, 223
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.