Rh2AG359200

cyclin-D1-binding protein 1 homolog

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
OG0002414
Physical Location & Seq
Forward (+)
53235497 .. 53237091
1595 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG359200.1

Sequence Viewer

Length: 396 bp
ATGGGAGTTTTGGTGGAAGTGAGTATCAGAGGCTTCCTCCTCCCCAAAATTCGAAACATTGGAATGCTTTGGAGTGGAGAAAGAGTAGAAGCTAGAGTGCTTGAAGAAAACATGACTACCTACTTTAATATGCTACAAGGTTTTCTTCTTCTTTCACATGGGAGTATGGTTGGTGCAGGGCCTACTCTTTCTTCTTGTGTCCACGCATCTGTAAAGCAAGTTGTTGACTCCAGTTTTAAGTTGATGAAGGAATTTATCTCGTTGTATGGAGCAGTGAATAAAGACTGGAAACTGTCGATTCCACAGTTGGCTGGTGCAGTATGGGAAGCCTGTTTTGCTCTTAAGAAGACCCCTGCCACAAATGTCATAGCAATTAGCTATTGTAATTGCTCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
GCIP

Protein Analysis

131

Amino Acids

14.36

Weight (kDa)

8.75

Isoelectric Point (pI)

25.96

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
GCIP_N PF13324 20 - 126 7.3e-30 Grap2 and cyclin-D-interacting, N-terminal
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 48, 251
AflII CTTAAG 1 cut(s) 341
AgsI TTSAA 1 cut(s) 104
AluBI AGCT 2 cut(s) 92, 378
AluI AGCT 2 cut(s) 92, 378
AoxI GGCC 1 cut(s) 179
ApoI RAATTY 2 cut(s) 48, 251
AspS9I GGNCC 1 cut(s) 179
AsuII TTCGAA 1 cut(s) 52
BbsI GAAGAC 1 cut(s) 353
BfaI CTAG 1 cut(s) 93
BfrI CTTAAG 1 cut(s) 341
BmgT120I GGNCC 1 cut(s) 179
BmsI GCATC 1 cut(s) 215
BpiI GAAGAC 1 cut(s) 353
BplI GAGNNNNNCTC 2 cut(s) 21, 53
BpmI CTGGAG 1 cut(s) 214
Bpu14I TTCGAA 1 cut(s) 52
BsaXI ACNNNNNCTCC 3 cut(s) 27, 69, 99
Bse1I ACTGG 2 cut(s) 231, 290
BseNI ACTGG 2 cut(s) 231, 290
BseRI GAGGAG 1 cut(s) 29
BsgI GTGCAG 2 cut(s) 195, 336
BshFI GGCC 1 cut(s) 181
BsmI GAATGC 1 cut(s) 69
BsnI GGCC 1 cut(s) 181
Bsp119I TTCGAA 1 cut(s) 52
BspANI GGCC 1 cut(s) 181
BspT104I TTCGAA 1 cut(s) 52
BspTI CTTAAG 1 cut(s) 341
BsrI ACTGG 2 cut(s) 231, 290
Bst4CI ACNGT 2 cut(s) 294, 306
BstAFI CTTAAG 1 cut(s) 341
BstBI TTCGAA 1 cut(s) 52
BstMWI GCNNNNNNNGC 1 cut(s) 335
BstV2I GAAGAC 1 cut(s) 353
BsuRI GGCC 1 cut(s) 181
BtsI GCAGTG 1 cut(s) 279
BtsIMutI CAGTG 1 cut(s) 279
Cfr13I GGNCC 1 cut(s) 179
CviAII CATG 2 cut(s) 112, 158
CviJI RGCY 6 cut(s) 33, 92, 181, 311, 329, 378
CviKI_1 RGCY 6 cut(s) 33, 92, 181, 311, 329, 378
EcoO109I RGGNCCY 1 cut(s) 179
FaeI CATG 2 cut(s) 115, 161
FaiI YATR 7 cut(s) 113, 131, 159, 167, 267, 322, 368
FalI AAGNNNNNCTT 2 cut(s) 129, 161
FatI CATG 2 cut(s) 111, 157
FspBI CTAG 1 cut(s) 93
GsuI CTGGAG 1 cut(s) 214
HaeIII GGCC 1 cut(s) 181
Hin1II CATG 2 cut(s) 115, 161
HincII GTYRAC 1 cut(s) 226
HindII GTYRAC 1 cut(s) 226
HinfI GANTC 2 cut(s) 227, 298
Hpy166II GTNNAC 2 cut(s) 202, 226
Hpy188I TCNGA 1 cut(s) 29
Hpy8I GTNNAC 2 cut(s) 202, 226
HpyAV CCTTC 1 cut(s) 241
HpyCH4III ACNGT 2 cut(s) 294, 306
HpyCH4V TGCA 2 cut(s) 176, 317
HpyF10VI GCNNNNNNNGC 1 cut(s) 335
Hsp92II CATG 2 cut(s) 115, 161
LmnI GCTCC 1 cut(s) 269
LpnPI CCDG 6 cut(s) 162, 244, 271, 297, 343, 366
LweI GCATC 1 cut(s) 215
MaeI CTAG 1 cut(s) 93
MboII GAAGA 5 cut(s) 116, 137, 140, 183, 358
MluCI AATT 4 cut(s) 48, 251, 372, 385
MlyI GAGTC 1 cut(s) 221
MnlI CCTC 3 cut(s) 23, 47, 50
MseI TTAA 4 cut(s) 126, 237, 342, 394
MslI CAYNNNNRTG 1 cut(s) 62
MspCI CTTAAG 1 cut(s) 341
Mva1269I GAATGC 1 cut(s) 69
MwoI GCNNNNNNNGC 1 cut(s) 335
NlaIII CATG 2 cut(s) 115, 161
NspV TTCGAA 1 cut(s) 52
PctI GAATGC 1 cut(s) 69
PfeI GAWTC 1 cut(s) 298
PleI GAGTC 1 cut(s) 221
PpsI GAGTC 1 cut(s) 221
PspPI GGNCC 1 cut(s) 179
RseI CAYNNNNRTG 1 cut(s) 62
SaqAI TTAA 4 cut(s) 126, 237, 342, 394
Sau96I GGNCC 1 cut(s) 179
SchI GAGTC 1 cut(s) 221
SetI ASST 4 cut(s) 94, 122, 142, 380
SfaNI GCATC 1 cut(s) 215
SfuI TTCGAA 1 cut(s) 52
SmiMI CAYNNNNRTG 1 cut(s) 62
SmlI CTYRAG 1 cut(s) 341
SmoI CTYRAG 1 cut(s) 341
Sse9I AATT 4 cut(s) 48, 251, 372, 385
SspMI CTAG 1 cut(s) 93
TaaI ACNGT 2 cut(s) 294, 306
TaqI TCGA 2 cut(s) 52, 296
TasI AATT 4 cut(s) 48, 251, 372, 385
TfiI GAWTC 1 cut(s) 298
Tru1I TTAA 4 cut(s) 126, 237, 342, 394
Tru9I TTAA 4 cut(s) 126, 237, 342, 394
TscAI CASTG 1 cut(s) 279
TspDTI ATGAA 1 cut(s) 260
TspRI CASTG 1 cut(s) 279
Vha464I CTTAAG 1 cut(s) 341
XapI RAATTY 2 cut(s) 48, 251
XspI CTAG 1 cut(s) 93
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.