Rh2DG326600

Cytochrome b6-f complex iron-sulfur subunit

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2D
OG0003668
Physical Location & Seq
Forward (+)
41127177 .. 41147201
20025 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2DG326600.1

Sequence Viewer

Length: 279 bp
ATGTTCTCTTCAGCACAGGCTCTGTCTCTGATGCCCAGGAGGACCCAGATGATGGGAAAGGGAAAGGGAATGGGAATCACATGCCAGGCCGCAATTCTAGCTGATATTGTCCCTGACATGGGTAAGAGGAACCTTATGAATCTGCTTCTTCTAACGAATCTCACTTCCCTCTGGTTTCCTATGCCACTTTCTTTGCTCCACCTGGTATTCGACACTGCCCCTGGAGTTTGGTTAGATAGAAACGGGCTTGTGACCTCCTCATGGACAGGCAAGGAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00195 ko01100 map00195 map01100
Pfam Domains
Protein Families
CytB6-F_Fe-S Rieske

Protein Analysis

92

Amino Acids

10.11

Weight (kDa)

9.62

Isoelectric Point (pI)

27.8

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
TM_PetC PF25471 36 - 53 1.6e-06 Iron-sulfur subunit PetC transmembrane anchor
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 52
AciI CCGC 1 cut(s) 90
AfiI CCNNNNNNNGG 4 cut(s) 52, 118, 119, 261
AjnI CCWGG 4 cut(s) 35, 84, 201, 220
AluBI AGCT 1 cut(s) 101
AluI AGCT 1 cut(s) 101
Alw26I GTCTC 1 cut(s) 30
AlwNI CAGNNNCTG 1 cut(s) 22
AoxI GGCC 1 cut(s) 87
AspS9I GGNCC 1 cut(s) 42
AvaII GGWCC 1 cut(s) 42
BccI CCATC 1 cut(s) 46
BciT130I CCWGG 4 cut(s) 37, 86, 203, 222
BcoDI GTCTC 1 cut(s) 30
BfaI CTAG 1 cut(s) 98
BisI GCNGC 1 cut(s) 90
BlsI GCNGC 1 cut(s) 91
Bme1390I CCNGG 4 cut(s) 37, 86, 203, 222
Bme18I GGWCC 1 cut(s) 42
BmgT120I GGNCC 1 cut(s) 42
BmiI GGNNCC 2 cut(s) 44, 131
BmrFI CCNGG 4 cut(s) 37, 86, 203, 222
BmsI GCATC 1 cut(s) 21
BpmI CTGGAG 1 cut(s) 243
BsaJI CCNNGG 2 cut(s) 35, 220
Bsc4I CCNNNNNNNGG 4 cut(s) 52, 118, 119, 261
BseBI CCWGG 4 cut(s) 37, 86, 203, 222
BseDI CCNNGG 2 cut(s) 35, 220
BseLI CCNNNNNNNGG 4 cut(s) 52, 118, 119, 261
BseRI GAGGAG 1 cut(s) 247
BshFI GGCC 1 cut(s) 89
BslFI GGGAC 1 cut(s) 95
BslI CCNNNNNNNGG 4 cut(s) 52, 118, 119, 261
BsmAI GTCTC 1 cut(s) 30
BsmFI GGGAC 1 cut(s) 95
BsnI GGCC 1 cut(s) 89
BspACI CCGC 1 cut(s) 90
BspANI GGCC 1 cut(s) 89
BspLI GGNNCC 2 cut(s) 44, 131
BssECI CCNNGG 2 cut(s) 35, 220
Bst2UI CCWGG 4 cut(s) 37, 86, 203, 222
Bst6I CTCTTC 1 cut(s) 13
BstMAI GTCTC 1 cut(s) 30
BstMWI GCNNNNNNNGC 1 cut(s) 98
BstNI CCWGG 4 cut(s) 37, 86, 203, 222
BstNSI RCATGY 1 cut(s) 84
BstSCI CCNGG 4 cut(s) 35, 84, 201, 220
BsuRI GGCC 1 cut(s) 89
BtsI GCAGTG 1 cut(s) 213
BtsIMutI CAGTG 1 cut(s) 213
CaiI CAGNNNCTG 1 cut(s) 22
Cfr13I GGNCC 1 cut(s) 42
CsiI ACCWGGT 1 cut(s) 201
CspCI CAANNNNNGTGG 2 cut(s) 174, 209
CviAII CATG 3 cut(s) 81, 118, 261
CviJI RGCY 4 cut(s) 20, 89, 101, 247
CviKI_1 RGCY 4 cut(s) 20, 89, 101, 247
Eam1104I CTCTTC 1 cut(s) 13
EarI CTCTTC 1 cut(s) 13
Eco47I GGWCC 1 cut(s) 42
EcoO109I RGGNCCY 1 cut(s) 42
EcoRII CCWGG 4 cut(s) 35, 84, 201, 220
FaeI CATG 3 cut(s) 84, 121, 264
FaiI YATR 5 cut(s) 82, 119, 137, 182, 262
FaqI GGGAC 1 cut(s) 95
FatI CATG 3 cut(s) 80, 117, 260
Fnu4HI GCNGC 1 cut(s) 90
Fsp4HI GCNGC 1 cut(s) 90
FspBI CTAG 1 cut(s) 98
GluI GCNGC 1 cut(s) 90
GsuI CTGGAG 1 cut(s) 243
HaeIII GGCC 1 cut(s) 89
Hin1II CATG 3 cut(s) 84, 121, 264
HinfI GANTC 3 cut(s) 75, 139, 157
Hpy188I TCNGA 1 cut(s) 30
HpyF10VI GCNNNNNNNGC 1 cut(s) 98
Hsp92II CATG 3 cut(s) 84, 121, 264
LmnI GCTCC 1 cut(s) 201
LweI GCATC 1 cut(s) 21
MabI ACCWGGT 1 cut(s) 201
MaeI CTAG 1 cut(s) 98
MaeIII GTNAC 1 cut(s) 250
MboII GAAGA 1 cut(s) 140
MluCI AATT 1 cut(s) 93
MnlI CCTC 5 cut(s) 33, 120, 179, 265, 268
MspR9I CCNGG 4 cut(s) 37, 86, 203, 222
MvaI CCWGG 4 cut(s) 37, 86, 203, 222
MwoI GCNNNNNNNGC 1 cut(s) 98
NlaIII CATG 3 cut(s) 84, 121, 264
NlaIV GGNNCC 2 cut(s) 44, 131
NmuCI GTSAC 1 cut(s) 250
NspI RCATGY 1 cut(s) 84
PfeI GAWTC 3 cut(s) 75, 139, 157
PflMI CCANNNNNTGG 1 cut(s) 52
PkrI GCNGC 1 cut(s) 91
PpuMI RGGWCCY 1 cut(s) 42
Psp5II RGGWCCY 1 cut(s) 42
Psp6I CCWGG 4 cut(s) 35, 84, 201, 220
PspGI CCWGG 4 cut(s) 35, 84, 201, 220
PspN4I GGNNCC 2 cut(s) 44, 131
PspPI GGNCC 1 cut(s) 42
PspPPI RGGWCCY 1 cut(s) 42
PstNI CAGNNNCTG 1 cut(s) 22
SatI GCNGC 1 cut(s) 90
Sau96I GGNCC 1 cut(s) 42
ScrFI CCNGG 4 cut(s) 37, 86, 203, 222
SetI ASST 4 cut(s) 103, 135, 204, 257
SexAI ACCWGGT 1 cut(s) 201
SfaNI GCATC 1 cut(s) 21
SinI GGWCC 1 cut(s) 42
Sse9I AATT 1 cut(s) 93
SsiI CCGC 1 cut(s) 90
SspMI CTAG 1 cut(s) 98
StyD4I CCNGG 4 cut(s) 35, 84, 201, 220
TaqI TCGA 1 cut(s) 210
TasI AATT 1 cut(s) 93
TauI GCSGC 1 cut(s) 92
TfiI GAWTC 3 cut(s) 75, 139, 157
TscAI CASTG 1 cut(s) 220
TseFI GTSAC 1 cut(s) 250
Tsp45I GTSAC 1 cut(s) 250
TspDTI ATGAA 1 cut(s) 152
TspRI CASTG 1 cut(s) 220
Van91I CCANNNNNTGG 1 cut(s) 52
VpaK11BI GGWCC 1 cut(s) 42
XceI RCATGY 1 cut(s) 84
XspI CTAG 1 cut(s) 98
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.