Rh3CG183100
ERF Family

May function in recognizing stalled ribosomes and triggering endonucleolytic cleavage of the mRNA, a mechanism to release non-functional ribosomes and degrade damaged mRNAs

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3C
Physical Location & Seq
Forward (+)
16114451 .. 16114861
411 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3CG183100.1

Sequence Viewer

Length: 411 bp
ATGATTGCGGAGGCGAATAGGTTGAAGGTCAAGTCAGTAGAGAACAACAAGCAACGCATTGTCGTTTTTAACACGAGGAGCAAAGGGAAAGACGGGAACAGTAGTTTGCTTGAGGTTTTGCATGACAGTACCGTGATGAACTTGGTCAGAGACACCAAGGCTGTGATGGAGATCAAGGCTTTTAAGGAGTTTTCGGATTTGCCAACAACGGATTTGGACCGAGTGTGTTATGATACCAAGAATGTGGAGATGGCGCATGAGTTGAAGGCCATTGAAACGCTATTGATTACCGATGACTTGTATGAGAGTGTAGAGATTGAGACGAGGTATAAGTACAGAGGGTTTGTGGAGTCGGAGAAAAAGACAGGAGGGAAGGCGTTTGAGTTTTCGTCCGAGCATGTATCCAGCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

136

Amino Acids

15.53

Weight (kDa)

5.68

Isoelectric Point (pI)

27.13

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
eRF1_3 PF03465 55 - 134 4.6e-10 eRF1 domain 3
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 8
AfaI GTAC 2 cut(s) 130, 335
AgsI TTSAA 3 cut(s) 25, 265, 275
AluBI AGCT 1 cut(s) 408
AluI AGCT 1 cut(s) 408
Alw26I GTCTC 2 cut(s) 144, 314
AoxI GGCC 1 cut(s) 267
AspLEI GCGC 1 cut(s) 256
AspS9I GGNCC 1 cut(s) 217
AvaII GGWCC 1 cut(s) 217
BauI CACGAG 1 cut(s) 73
BccI CCATC 2 cut(s) 160, 244
BcoDI GTCTC 2 cut(s) 144, 314
BfaI CTAG 1 cut(s) 409
Bme18I GGWCC 1 cut(s) 217
BmgT120I GGNCC 1 cut(s) 217
BpuEI CTTGAG 1 cut(s) 131
BsaBI GATNNNNATC 1 cut(s) 170
BsaJI CCNNGG 1 cut(s) 156
Bse8I GATNNNNATC 1 cut(s) 170
BseDI CCNNGG 1 cut(s) 156
BseJI GATNNNNATC 1 cut(s) 170
BseRI GAGGAG 1 cut(s) 91
BshFI GGCC 1 cut(s) 269
BsmAI GTCTC 2 cut(s) 144, 314
BsmBI CGTCTC 1 cut(s) 314
BsnI GGCC 1 cut(s) 269
Bsp143I GATC 1 cut(s) 171
BspACI CCGC 1 cut(s) 8
BspANI GGCC 1 cut(s) 269
BssECI CCNNGG 1 cut(s) 156
BssMI GATC 1 cut(s) 171
BssSI CACGAG 1 cut(s) 73
BssT1I CCWWGG 1 cut(s) 156
Bst2BI CACGAG 1 cut(s) 73
Bst4CI ACNGT 3 cut(s) 101, 128, 133
BstHHI GCGC 1 cut(s) 256
BstKTI GATC 1 cut(s) 174
BstMAI GTCTC 2 cut(s) 144, 314
BstMBI GATC 1 cut(s) 171
BstNSI RCATGY 1 cut(s) 401
BstXI CCANNNNNNTGG 1 cut(s) 244
BsuRI GGCC 1 cut(s) 269
CfoI GCGC 1 cut(s) 256
Cfr13I GGNCC 1 cut(s) 217
Csp6I GTAC 2 cut(s) 129, 334
CviAII CATG 3 cut(s) 122, 257, 398
CviJI RGCY 4 cut(s) 161, 179, 269, 408
CviKI_1 RGCY 4 cut(s) 161, 179, 269, 408
CviQI GTAC 2 cut(s) 129, 334
DpnI GATC 1 cut(s) 173
DpnII GATC 1 cut(s) 171
Eco130I CCWWGG 1 cut(s) 156
Eco47I GGWCC 1 cut(s) 217
EcoT14I CCWWGG 1 cut(s) 156
ErhI CCWWGG 1 cut(s) 156
Esp3I CGTCTC 1 cut(s) 314
FaeI CATG 3 cut(s) 125, 260, 401
FaiI YATR 6 cut(s) 123, 231, 258, 303, 330, 399
FatI CATG 3 cut(s) 121, 256, 397
FspBI CTAG 1 cut(s) 409
GlaI GCGC 1 cut(s) 255
HaeIII GGCC 1 cut(s) 269
HhaI GCGC 1 cut(s) 256
Hin1II CATG 3 cut(s) 125, 260, 401
Hin6I GCGC 1 cut(s) 254
HinP1I GCGC 1 cut(s) 254
HinfI GANTC 1 cut(s) 350
Hpy188I TCNGA 4 cut(s) 149, 196, 355, 394
HpyAV CCTTC 3 cut(s) 19, 259, 367
HpyCH4III ACNGT 3 cut(s) 101, 128, 133
HpyCH4V TGCA 1 cut(s) 121
Hsp92II CATG 3 cut(s) 125, 260, 401
HspAI GCGC 1 cut(s) 254
Kzo9I GATC 1 cut(s) 171
LmnI GCTCC 1 cut(s) 78
LpnPI CCDG 1 cut(s) 351
MaeI CTAG 1 cut(s) 409
MalI GATC 1 cut(s) 173
MboI GATC 1 cut(s) 171
MlyI GAGTC 1 cut(s) 359
MmeI TCCRAC 1 cut(s) 333
MnlI CCTC 6 cut(s) 4, 69, 106, 318, 332, 362
MseI TTAA 2 cut(s) 69, 183
NdeII GATC 1 cut(s) 171
NlaIII CATG 3 cut(s) 125, 260, 401
NspI RCATGY 1 cut(s) 401
PleI GAGTC 1 cut(s) 358
PpsI GAGTC 1 cut(s) 358
PspPI GGNCC 1 cut(s) 217
RsaI GTAC 2 cut(s) 130, 335
RsaNI GTAC 2 cut(s) 129, 334
SaqAI TTAA 2 cut(s) 69, 183
Sau3AI GATC 1 cut(s) 171
Sau96I GGNCC 1 cut(s) 217
SchI GAGTC 1 cut(s) 359
SetI ASST 5 cut(s) 23, 30, 117, 329, 410
SinI GGWCC 1 cut(s) 217
SmlI CTYRAG 1 cut(s) 110
SmoI CTYRAG 1 cut(s) 110
SsiI CCGC 1 cut(s) 8
SspMI CTAG 1 cut(s) 409
StyI CCWWGG 1 cut(s) 156
TaaI ACNGT 3 cut(s) 101, 128, 133
TaqII GACCGA 1 cut(s) 234
TatI WGTACW 1 cut(s) 333
Tru1I TTAA 2 cut(s) 69, 183
Tru9I TTAA 2 cut(s) 69, 183
TspDTI ATGAA 1 cut(s) 152
TspGWI ACGGA 1 cut(s) 224
VpaK11BI GGWCC 1 cut(s) 217
XceI RCATGY 1 cut(s) 401
XcmI CCANNNNNNNNNTGG 1 cut(s) 163
XspI CTAG 1 cut(s) 409
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.