Rh3DG242200

component of the eukaryotic translation initiation factor 3 (eIF-3) complex, which is involved in protein synthesis of a specialized repertoire of mRNAs and, together with other initiation factors, stimulates binding of mRNA and methionyl-tRNAi to the 40S ribosome. The eIF-3 complex specifically targets and initiates translation of a subset of mRNAs involved in cell proliferation

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3D
Physical Location & Seq
Reverse (-)
23248433 .. 23252688
4256 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3DG242200.1

Sequence Viewer

Length: 354 bp
ATGGCTTCGACTTCGAAATTCTGGGGCCGCCAGAGTGATCAAAGTGACAGCGATAGCGATTCAGAAGATGAGCCTGTAATCACAGATGAGGAGACGACTAGCATTAAGAAAATCAAAAACAAATACGAAATTGAAAGTGATGATGAGGAAAGCTCTGATGACGAAAAGCGTGTGGTTAAGTCAGGGAGAGCTAAGCGATTCGAGGAGATGTGTGCTACTGTTGACAAGATAAACAAGGCAAAGAACATAAACGATTGGGTGAGCTTGCAGGACTCGTTTGACAAGATGAATAAACAGCTTGACACTACTAGAATTTACCCTTTTAGTCACAAAATTATAGGTGACAAACCTTAA

Protein Analysis

117

Amino Acids

13.49

Weight (kDa)

4.78

Isoelectric Point (pI)

70.89

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
eIF-3c_N PF05470 45 - 102 1.7e-14 Eukaryotic translation initiation factor 3 subunit 8 N-terminus
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 28
AcsI RAATTY 2 cut(s) 17, 312
AgsI TTSAA 1 cut(s) 134
AluBI AGCT 4 cut(s) 153, 191, 264, 298
AluI AGCT 4 cut(s) 153, 191, 264, 298
Alw26I GTCTC 1 cut(s) 86
AoxI GGCC 1 cut(s) 25
ApoI RAATTY 2 cut(s) 17, 312
AspS9I GGNCC 1 cut(s) 25
AsuHPI GGTGA 2 cut(s) 271, 353
AsuII TTCGAA 1 cut(s) 14
BclI TGATCA 1 cut(s) 37
BcoDI GTCTC 1 cut(s) 86
BfaI CTAG 2 cut(s) 99, 309
BisI GCNGC 1 cut(s) 28
BlpI GCTNAGC 1 cut(s) 192
BlsI GCNGC 1 cut(s) 29
BmgT120I GGNCC 1 cut(s) 25
BmiI GGNNCC 1 cut(s) 26
BplI GAGNNNNNCTC 2 cut(s) 137, 169
Bpu1102I GCTNAGC 1 cut(s) 192
Bpu14I TTCGAA 1 cut(s) 14
BseRI GAGGAG 2 cut(s) 104, 218
BshFI GGCC 1 cut(s) 27
BsmAI GTCTC 1 cut(s) 86
BsmBI CGTCTC 1 cut(s) 86
BsnI GGCC 1 cut(s) 27
Bsp119I TTCGAA 1 cut(s) 14
Bsp143I GATC 1 cut(s) 37
Bsp1720I GCTNAGC 1 cut(s) 192
BspACI CCGC 1 cut(s) 28
BspANI GGCC 1 cut(s) 27
BspLI GGNNCC 1 cut(s) 26
BspT104I TTCGAA 1 cut(s) 14
BssMI GATC 1 cut(s) 37
Bst4CI ACNGT 1 cut(s) 220
BstBI TTCGAA 1 cut(s) 14
BstC8I GCNNGC 1 cut(s) 266
BstDEI CTNAG 1 cut(s) 192
BstKTI GATC 1 cut(s) 40
BstMAI GTCTC 1 cut(s) 86
BstMBI GATC 1 cut(s) 37
BsuRI GGCC 1 cut(s) 27
Cac8I GCNNGC 1 cut(s) 266
Cfr13I GGNCC 1 cut(s) 25
CviJI RGCY 7 cut(s) 5, 27, 73, 153, 191, 264, 298
CviKI_1 RGCY 7 cut(s) 5, 27, 73, 153, 191, 264, 298
DdeI CTNAG 1 cut(s) 192
DpnI GATC 1 cut(s) 39
DpnII GATC 1 cut(s) 37
Esp3I CGTCTC 1 cut(s) 86
FaiI YATR 2 cut(s) 248, 338
FbaI TGATCA 1 cut(s) 37
Fnu4HI GCNGC 1 cut(s) 28
Fsp4HI GCNGC 1 cut(s) 28
FspBI CTAG 2 cut(s) 99, 309
GluI GCNGC 1 cut(s) 28
HaeIII GGCC 1 cut(s) 27
HincII GTYRAC 1 cut(s) 223
HindII GTYRAC 1 cut(s) 223
HinfI GANTC 3 cut(s) 59, 198, 272
HphI GGTGA 2 cut(s) 271, 353
Hpy166II GTNNAC 1 cut(s) 223
Hpy188I TCNGA 2 cut(s) 64, 157
Hpy8I GTNNAC 1 cut(s) 223
HpyCH4III ACNGT 1 cut(s) 220
HpyCH4V TGCA 1 cut(s) 268
HpyF3I CTNAG 1 cut(s) 192
Ksp22I TGATCA 1 cut(s) 37
Kzo9I GATC 1 cut(s) 37
LpnPI CCDG 5 cut(s) 7, 44, 87, 168, 254
MaeI CTAG 2 cut(s) 99, 309
MaeIII GTNAC 3 cut(s) 44, 326, 341
MalI GATC 1 cut(s) 39
MboI GATC 1 cut(s) 37
MboII GAAGA 1 cut(s) 77
MluCI AATT 4 cut(s) 17, 129, 312, 333
MlyI GAGTC 1 cut(s) 266
MnlI CCTC 3 cut(s) 82, 139, 196
MseI TTAA 3 cut(s) 105, 177, 352
NdeII GATC 1 cut(s) 37
NlaIV GGNNCC 1 cut(s) 26
NmuCI GTSAC 3 cut(s) 44, 326, 341
NspV TTCGAA 1 cut(s) 14
PfeI GAWTC 2 cut(s) 59, 198
PkrI GCNGC 1 cut(s) 29
PleI GAGTC 1 cut(s) 266
PpsI GAGTC 1 cut(s) 266
PspN4I GGNNCC 1 cut(s) 26
PspPI GGNCC 1 cut(s) 25
SaqAI TTAA 3 cut(s) 105, 177, 352
SatI GCNGC 1 cut(s) 28
Sau3AI GATC 1 cut(s) 37
Sau96I GGNCC 1 cut(s) 25
SchI GAGTC 1 cut(s) 266
SetI ASST 6 cut(s) 155, 193, 266, 300, 343, 352
SfuI TTCGAA 1 cut(s) 14
Sse9I AATT 4 cut(s) 17, 129, 312, 333
SsiI CCGC 1 cut(s) 28
SspMI CTAG 2 cut(s) 99, 309
TaaI ACNGT 1 cut(s) 220
TaqI TCGA 3 cut(s) 8, 14, 201
TasI AATT 4 cut(s) 17, 129, 312, 333
TauI GCSGC 1 cut(s) 30
TfiI GAWTC 2 cut(s) 59, 198
Tru1I TTAA 3 cut(s) 105, 177, 352
Tru9I TTAA 3 cut(s) 105, 177, 352
TseFI GTSAC 3 cut(s) 44, 326, 341
Tsp45I GTSAC 3 cut(s) 44, 326, 341
TspDTI ATGAA 1 cut(s) 302
XapI RAATTY 2 cut(s) 17, 312
XspI CTAG 2 cut(s) 99, 309
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.