Rh4AG068200

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4A
Physical Location & Seq
Forward (+)
14304108 .. 14306197
2090 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4AG068200.1

Sequence Viewer

Length: 210 bp
ATGGGAGAGGAGGAAGGGAGAATTTATCAAGGCCAAGAAAGGTGGTTGTTTGTGAATTTTGCAGAATGGAATAGCAGAGAAGAATTGGCGGGGGAGAGTTTGGGTTCGGTTTTCGTTGGGATCGACAATGAGAATTGGGAACCTACTAAAAGCTCTTATCTAGGATTGCATGGAGCAAAACTCGATAACAAAGGGTTCCATCATGAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

69

Amino Acids

7.93

Weight (kDa)

4.8

Isoelectric Point (pI)

37.6

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 89
AclWI GGATC 1 cut(s) 128
AcsI RAATTY 2 cut(s) 21, 55
AluBI AGCT 1 cut(s) 153
AluI AGCT 1 cut(s) 153
AlwI GGATC 1 cut(s) 128
AoxI GGCC 1 cut(s) 31
ApoI RAATTY 2 cut(s) 21, 55
BccI CCATC 1 cut(s) 207
BfaI CTAG 1 cut(s) 161
BmiI GGNNCC 2 cut(s) 141, 197
BplI GAGNNNNNCTC 2 cut(s) 165, 197
BseRI GAGGAG 1 cut(s) 23
BshFI GGCC 1 cut(s) 33
BsnI GGCC 1 cut(s) 33
Bsp143I GATC 1 cut(s) 120
BspACI CCGC 1 cut(s) 89
BspANI GGCC 1 cut(s) 33
BspHI TCATGA 1 cut(s) 202
BspLI GGNNCC 2 cut(s) 141, 197
BspPI GGATC 1 cut(s) 128
BssMI GATC 1 cut(s) 120
BstKTI GATC 1 cut(s) 123
BstMBI GATC 1 cut(s) 120
BsuRI GGCC 1 cut(s) 33
CciI TCATGA 1 cut(s) 202
CspCI CAANNNNNGTGG 2 cut(s) 23, 58
CviAII CATG 2 cut(s) 170, 203
CviJI RGCY 2 cut(s) 33, 153
CviKI_1 RGCY 2 cut(s) 33, 153
DpnI GATC 1 cut(s) 122
DpnII GATC 1 cut(s) 120
FaeI CATG 2 cut(s) 173, 206
FaiI YATR 2 cut(s) 171, 204
FatI CATG 2 cut(s) 169, 202
FauI CCCGC 1 cut(s) 82
FspBI CTAG 1 cut(s) 161
HaeIII GGCC 1 cut(s) 33
Hin1II CATG 2 cut(s) 173, 206
Hpy188III TCNNGA 1 cut(s) 203
HpyAV CCTTC 1 cut(s) 8
HpyCH4V TGCA 2 cut(s) 62, 169
Hsp92II CATG 2 cut(s) 173, 206
Kzo9I GATC 1 cut(s) 120
LmnI GCTCC 1 cut(s) 173
MaeI CTAG 1 cut(s) 161
MalI GATC 1 cut(s) 122
MboI GATC 1 cut(s) 120
MboII GAAGA 1 cut(s) 92
MluCI AATT 4 cut(s) 21, 55, 83, 133
MnlI CCTC 1 cut(s) 4
NdeII GATC 1 cut(s) 120
NlaIII CATG 2 cut(s) 173, 206
NlaIV GGNNCC 2 cut(s) 141, 197
PagI TCATGA 1 cut(s) 202
PcsI WCGNNNNNNNCGW 1 cut(s) 120
PspN4I GGNNCC 2 cut(s) 141, 197
Sau3AI GATC 1 cut(s) 120
SetI ASST 3 cut(s) 44, 145, 155
SgeI CNNG 6 cut(s) 41, 47, 102, 173, 182, 194
Sse9I AATT 4 cut(s) 21, 55, 83, 133
SsiI CCGC 1 cut(s) 89
SspMI CTAG 1 cut(s) 161
TaqI TCGA 2 cut(s) 123, 183
TasI AATT 4 cut(s) 21, 55, 83, 133
XapI RAATTY 2 cut(s) 21, 55
XspI CTAG 1 cut(s) 161
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.