Rh6CG080000

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6C
OG0003459
Physical Location & Seq
Reverse (-)
8667452 .. 8669040
1589 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6CG080000.1

Sequence Viewer

Length: 300 bp
ATGGAGAACGCAATTTTCACTCCAAATCTGGAGTATATTCTGTTTAGTGGAGGCCAGGGTCCATTTTGTGGAATCTCCACCGAAAAAGTGGAGATAGATAGTCGTGATGCTGAGGGTCTCATAATACCAGAACATTGCAGAAGGGTAGGGTCTCCACCATTACCTAGTGTCAAGCAGCTGCAGCTAACCTTTGCTGTTCCAATTTCTGCCAAGGGGTCTCATATTTCCAGAACTTTTCAAAGCTATGGTATCGATCAACCATTACCTAGTTCCAAGCAGCTGGAGGACGCCAGAGATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

99

Amino Acids

10.83

Weight (kDa)

5.28

Isoelectric Point (pI)

67.2

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 68
AcyI GRCGYC 1 cut(s) 288
AfiI CCNNNNNNNGG 1 cut(s) 68
AgsI TTSAA 1 cut(s) 239
AjnI CCWGG 1 cut(s) 54
AluBI AGCT 4 cut(s) 178, 184, 243, 280
AluI AGCT 4 cut(s) 178, 184, 243, 280
Alw26I GTCTC 3 cut(s) 122, 156, 222
AoxI GGCC 1 cut(s) 52
ApeKI GCWGC 4 cut(s) 175, 178, 181, 277
AspS9I GGNCC 1 cut(s) 59
AvaII GGWCC 1 cut(s) 59
BbvCI CCTCAGC 1 cut(s) 111
BbvI GCAGC 4 cut(s) 165, 187, 193, 289
BciT130I CCWGG 1 cut(s) 56
BcoDI GTCTC 3 cut(s) 122, 156, 222
BfaI CTAG 2 cut(s) 165, 267
BfmI CTRYAG 1 cut(s) 179
BisI GCNGC 4 cut(s) 176, 179, 182, 278
BlsI GCNGC 4 cut(s) 177, 180, 183, 279
Bme1390I CCNGG 1 cut(s) 56
Bme18I GGWCC 1 cut(s) 59
BmgT120I GGNCC 1 cut(s) 59
BmiI GGNNCC 1 cut(s) 60
BmrFI CCNGG 1 cut(s) 56
BmsI GCATC 1 cut(s) 97
BpmI CTGGAG 1 cut(s) 50
Bpu10I CCTNAGC 1 cut(s) 111
Bsa29I ATCGAT 1 cut(s) 252
BsaHI GRCGYC 1 cut(s) 288
BsaI GGTCTC 3 cut(s) 122, 156, 222
BsaJI CCNNGG 2 cut(s) 55, 210
Bsc4I CCNNNNNNNGG 1 cut(s) 68
Bse3DI GCAATG 1 cut(s) 133
BseBI CCWGG 1 cut(s) 56
BseCI ATCGAT 1 cut(s) 252
BseDI CCNNGG 2 cut(s) 55, 210
BseLI CCNNNNNNNGG 1 cut(s) 68
BseMI GCAATG 1 cut(s) 133
BseMII CTCAG 1 cut(s) 102
BseXI GCAGC 4 cut(s) 165, 187, 193, 289
BshFI GGCC 1 cut(s) 54
BshVI ATCGAT 1 cut(s) 252
BslI CCNNNNNNNGG 1 cut(s) 68
BsmAI GTCTC 3 cut(s) 122, 156, 222
BsnI GGCC 1 cut(s) 54
Bso31I GGTCTC 3 cut(s) 122, 156, 222
Bsp143I GATC 1 cut(s) 253
BspANI GGCC 1 cut(s) 54
BspCNI CTCAG 1 cut(s) 103
BspDI ATCGAT 1 cut(s) 252
BspLI GGNNCC 1 cut(s) 60
BspMAI CTGCAG 1 cut(s) 183
BspTNI GGTCTC 3 cut(s) 122, 156, 222
BsrDI GCAATG 1 cut(s) 133
BssECI CCNNGG 2 cut(s) 55, 210
BssMI GATC 1 cut(s) 253
BssNI GRCGYC 1 cut(s) 288
BssT1I CCWWGG 1 cut(s) 210
Bst2UI CCWGG 1 cut(s) 56
BstACI GRCGYC 1 cut(s) 288
BstDEI CTNAG 1 cut(s) 111
BstKTI GATC 1 cut(s) 256
BstMAI GTCTC 3 cut(s) 122, 156, 222
BstMBI GATC 1 cut(s) 253
BstMWI GCNNNNNNNGC 1 cut(s) 181
BstNI CCWGG 1 cut(s) 56
BstSCI CCNGG 1 cut(s) 54
BstSFI CTRYAG 1 cut(s) 179
BstV1I GCAGC 4 cut(s) 165, 187, 193, 289
BstXI CCANNNNNNTGG 1 cut(s) 280
Bsu15I ATCGAT 1 cut(s) 252
BsuRI GGCC 1 cut(s) 54
BsuTUI ATCGAT 1 cut(s) 252
Cfr13I GGNCC 1 cut(s) 59
ClaI ATCGAT 1 cut(s) 252
CviJI RGCY 5 cut(s) 54, 178, 184, 243, 280
CviKI_1 RGCY 5 cut(s) 54, 178, 184, 243, 280
DdeI CTNAG 1 cut(s) 111
DpnI GATC 1 cut(s) 255
DpnII GATC 1 cut(s) 253
Eco130I CCWWGG 1 cut(s) 210
Eco31I GGTCTC 3 cut(s) 122, 156, 222
Eco47I GGWCC 1 cut(s) 59
EcoRII CCWGG 1 cut(s) 54
EcoT14I CCWWGG 1 cut(s) 210
ErhI CCWWGG 1 cut(s) 210
FaiI YATR 4 cut(s) 36, 122, 222, 246
Fnu4HI GCNGC 4 cut(s) 176, 179, 182, 278
Fsp4HI GCNGC 4 cut(s) 176, 179, 182, 278
FspBI CTAG 2 cut(s) 165, 267
GluI GCNGC 4 cut(s) 176, 179, 182, 278
GsuI CTGGAG 1 cut(s) 50
HaeIII GGCC 1 cut(s) 54
Hin1I GRCGYC 1 cut(s) 288
HinfI GANTC 1 cut(s) 72
Hpy188III TCNNGA 3 cut(s) 29, 104, 228
HpyAV CCTTC 1 cut(s) 135
HpyCH4V TGCA 2 cut(s) 138, 181
HpyF10VI GCNNNNNNNGC 1 cut(s) 181
HpyF3I CTNAG 1 cut(s) 111
Hsp92I GRCGYC 1 cut(s) 288
Kzo9I GATC 1 cut(s) 253
LpnPI CCDG 6 cut(s) 14, 41, 68, 141, 241, 266
Lsp1109I GCAGC 4 cut(s) 165, 187, 193, 289
LweI GCATC 1 cut(s) 97
MaeI CTAG 2 cut(s) 165, 267
MalI GATC 1 cut(s) 255
MboI GATC 1 cut(s) 253
MluCI AATT 2 cut(s) 12, 201
MnlI CCTC 3 cut(s) 44, 106, 277
MspA1I CMGCKG 2 cut(s) 178, 280
MspR9I CCNGG 1 cut(s) 56
MvaI CCWGG 1 cut(s) 56
MwoI GCNNNNNNNGC 1 cut(s) 181
NdeII GATC 1 cut(s) 253
NlaIV GGNNCC 1 cut(s) 60
PfeI GAWTC 1 cut(s) 72
PflMI CCANNNNNTGG 1 cut(s) 68
PkrI GCNGC 4 cut(s) 177, 180, 183, 279
Psp6I CCWGG 1 cut(s) 54
PspGI CCWGG 1 cut(s) 54
PspN4I GGNNCC 1 cut(s) 60
PspPI GGNCC 1 cut(s) 59
PstI CTGCAG 1 cut(s) 183
PvuII CAGCTG 2 cut(s) 178, 280
SatI GCNGC 4 cut(s) 176, 179, 182, 278
Sau3AI GATC 1 cut(s) 253
Sau96I GGNCC 1 cut(s) 59
ScrFI CCNGG 1 cut(s) 56
SetI ASST 7 cut(s) 166, 180, 186, 191, 245, 268, 282
SfaNI GCATC 1 cut(s) 97
SfcI CTRYAG 1 cut(s) 179
SinI GGWCC 1 cut(s) 59
Sse9I AATT 2 cut(s) 12, 201
SspMI CTAG 2 cut(s) 165, 267
StyD4I CCNGG 1 cut(s) 54
StyI CCWWGG 1 cut(s) 210
TaqI TCGA 1 cut(s) 252
TasI AATT 2 cut(s) 12, 201
TfiI GAWTC 1 cut(s) 72
TseI GCWGC 4 cut(s) 175, 178, 181, 277
Van91I CCANNNNNTGG 1 cut(s) 68
VpaK11BI GGWCC 1 cut(s) 59
XcmI CCANNNNNNNNNTGG 1 cut(s) 85
XspI CTAG 2 cut(s) 165, 267
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.