Rh6DG256600

COBW domain-containing protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6D
Physical Location & Seq
Forward (+)
44674637 .. 44674943
307 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6DG256600.1

Sequence Viewer

Length: 228 bp
ATGGTCTCTGCCTCAAGCTACAATCTTGACGAGAATCCGAGCTTGGGTCTCGATACCCGTGTTCCGGCGACCATTATCACCGGCTTTCTCGGTTCCGGAAAGACTACATTGCTCAATCATATACTAACATCTCAACATGGAAAGCGGATTGCGTTCATAGAAAATGAGGCATCTCTTACTCTGTTTTGTTTTCCCTATACACTTCAACACACCCATCAAGAAATATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

75

Amino Acids

8.26

Weight (kDa)

6.0

Isoelectric Point (pI)

44.09

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
cobW PF02492 22 - 58 5e-13 CobW/HypB/UreG, nucleotide-binding domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 1 cut(s) 95
AciI CCGC 1 cut(s) 145
AfiI CCNNNNNNNGG 2 cut(s) 44, 64
AgsI TTSAA 1 cut(s) 206
AjuI GAANNNNNNNTTGG 2 cut(s) 26, 58
AluBI AGCT 2 cut(s) 18, 42
AluI AGCT 2 cut(s) 18, 42
Alw26I GTCTC 2 cut(s) 10, 53
Aor13HI TCCGGA 1 cut(s) 95
AsuHPI GGTGA 1 cut(s) 70
BaeI ACNNNNGTAYC 2 cut(s) 45, 78
BccI CCATC 1 cut(s) 222
BcoDI GTCTC 2 cut(s) 10, 53
BmiI GGNNCC 1 cut(s) 94
BmsI GCATC 1 cut(s) 179
BsaI GGTCTC 2 cut(s) 10, 53
BsaWI WCCGGW 1 cut(s) 95
Bsc4I CCNNNNNNNGG 2 cut(s) 44, 64
Bse118I RCCGGY 1 cut(s) 80
Bse3DI GCAATG 1 cut(s) 107
BseAI TCCGGA 1 cut(s) 95
BseLI CCNNNNNNNGG 2 cut(s) 44, 64
BseMI GCAATG 1 cut(s) 107
BsiSI CCGG 3 cut(s) 65, 81, 96
BslI CCNNNNNNNGG 2 cut(s) 44, 64
BsmAI GTCTC 2 cut(s) 10, 53
Bso31I GGTCTC 2 cut(s) 10, 53
Bsp13I TCCGGA 1 cut(s) 95
BspACI CCGC 1 cut(s) 145
BspEI TCCGGA 1 cut(s) 95
BspLI GGNNCC 1 cut(s) 94
BspTNI GGTCTC 2 cut(s) 10, 53
BsrDI GCAATG 1 cut(s) 107
BsrFI RCCGGY 1 cut(s) 80
BssAI RCCGGY 1 cut(s) 80
BstMAI GTCTC 2 cut(s) 10, 53
Cfr10I RCCGGY 1 cut(s) 80
CviAII CATG 1 cut(s) 137
CviJI RGCY 3 cut(s) 18, 42, 84
CviKI_1 RGCY 3 cut(s) 18, 42, 84
Eco31I GGTCTC 2 cut(s) 10, 53
FaeI CATG 1 cut(s) 140
FaiI YATR 6 cut(s) 120, 122, 138, 158, 198, 226
FatI CATG 1 cut(s) 136
HapII CCGG 3 cut(s) 65, 81, 96
Hin1II CATG 1 cut(s) 140
HinfI GANTC 1 cut(s) 34
HpaII CCGG 3 cut(s) 65, 81, 96
HphI GGTGA 1 cut(s) 70
Hpy188I TCNGA 1 cut(s) 39
Hpy188III TCNNGA 4 cut(s) 26, 50, 96, 218
Hsp92II CATG 1 cut(s) 140
Kpn2I TCCGGA 1 cut(s) 95
LpnPI CCDG 3 cut(s) 78, 94, 109
LweI GCATC 1 cut(s) 179
MnlI CCTC 2 cut(s) 22, 160
MroI TCCGGA 1 cut(s) 95
MspI CCGG 3 cut(s) 65, 81, 96
NlaIII CATG 1 cut(s) 140
NlaIV GGNNCC 1 cut(s) 94
PfeI GAWTC 1 cut(s) 34
PspN4I GGNNCC 1 cut(s) 94
SetI ASST 2 cut(s) 20, 44
SfaNI GCATC 1 cut(s) 179
SmlI CTYRAG 1 cut(s) 13
SmoI CTYRAG 1 cut(s) 13
SsiI CCGC 1 cut(s) 145
TaqI TCGA 1 cut(s) 51
TfiI GAWTC 1 cut(s) 34
TspDTI ATGAA 1 cut(s) 145
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.