Rh7BG146800

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7B
OG0001416
Physical Location & Seq
Forward (+)
10898560 .. 10900413
1854 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7BG146800.1

Sequence Viewer

Length: 495 bp
ATGAATTCAAATCTTGAATGTGCGATGGATGCTGTGGAGGTTGAAAATGAGAGAAAATCTTTGAAAGGTCTGGATATAGTGGTGTCTGTAGAGAGTGAAGGTGTAGTGAGAACATCACAATCTGCTCTCCCACTGGATTGCATGAACACTGGTGATTCTGACTTGCATAGGGAAGGAAAGGATTCATTTGCTACAGATGAACAGACATACAAGGATGAAAATGCTAGTATTAGTGATAATATCAGGACCCTTGGTGGGGGTATTGAGAACAGAATGATGGGGAGCAAAGCTGATATGGAGGACTATGTCACTTATAGAGAAAATAATAATATTGGCAACTGCTTGACTGAAGGAGATCGATACTGCAGCAAGGGTGACAAAAACAATCAGAAAGAAAAGGAGAATGTTGATGAGGATCTAGCTTTTCAAGAAGATGAGGAAAATAAAGACGGGGCTGTAGAGTTGAAGAAATGTTGGATGCTATGCCTGATTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

164

Amino Acids

18.35

Weight (kDa)

4.35

Isoelectric Point (pI)

38.66

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 423
AcsI RAATTY 1 cut(s) 4
AcuI CTGAAG 1 cut(s) 369
AfiI CCNNNNNNNGG 2 cut(s) 255, 256
AgsI TTSAA 6 cut(s) 9, 17, 44, 64, 428, 466
AluBI AGCT 2 cut(s) 290, 422
AluI AGCT 2 cut(s) 290, 422
AlwI GGATC 1 cut(s) 423
ApeKI GCWGC 1 cut(s) 366
ApoI RAATTY 1 cut(s) 4
Asp700I GAANNNNTTC 1 cut(s) 181
AspS9I GGNCC 1 cut(s) 246
AsuHPI GGTGA 2 cut(s) 164, 386
AvaII GGWCC 1 cut(s) 246
BbvI GCAGC 1 cut(s) 378
BccI CCATC 2 cut(s) 19, 271
BfaI CTAG 2 cut(s) 225, 419
BfmI CTRYAG 4 cut(s) 87, 192, 364, 456
BisI GCNGC 1 cut(s) 367
BlsI GCNGC 1 cut(s) 368
Bme18I GGWCC 1 cut(s) 246
BmgT120I GGNCC 1 cut(s) 246
BmiI GGNNCC 1 cut(s) 248
BmsI GCATC 2 cut(s) 19, 468
Bsa29I ATCGAT 1 cut(s) 358
BsaBI GATNNNNATC 1 cut(s) 414
BsaJI CCNNGG 1 cut(s) 250
Bsc4I CCNNNNNNNGG 2 cut(s) 255, 256
Bse1I ACTGG 2 cut(s) 138, 154
Bse8I GATNNNNATC 1 cut(s) 414
BseCI ATCGAT 1 cut(s) 358
BseDI CCNNGG 1 cut(s) 250
BseGI GGATG 3 cut(s) 34, 220, 483
BseJI GATNNNNATC 1 cut(s) 414
BseLI CCNNNNNNNGG 2 cut(s) 255, 256
BseNI ACTGG 2 cut(s) 138, 154
BseXI GCAGC 1 cut(s) 378
BshVI ATCGAT 1 cut(s) 358
BslI CCNNNNNNNGG 2 cut(s) 255, 256
Bsp143I GATC 2 cut(s) 355, 415
BspDI ATCGAT 1 cut(s) 358
BspLI GGNNCC 1 cut(s) 248
BspMAI CTGCAG 1 cut(s) 368
BspPI GGATC 1 cut(s) 423
BsrI ACTGG 2 cut(s) 138, 154
BssECI CCNNGG 1 cut(s) 250
BssMI GATC 2 cut(s) 355, 415
BssT1I CCWWGG 1 cut(s) 250
BstF5I GGATG 3 cut(s) 34, 220, 483
BstKTI GATC 2 cut(s) 358, 418
BstMBI GATC 2 cut(s) 355, 415
BstMWI GCNNNNNNNGC 1 cut(s) 29
BstSFI CTRYAG 4 cut(s) 87, 192, 364, 456
BstV1I GCAGC 1 cut(s) 378
BstX2I RGATCY 1 cut(s) 415
BstYI RGATCY 1 cut(s) 415
Bsu15I ATCGAT 1 cut(s) 358
BsuTUI ATCGAT 1 cut(s) 358
BtgZI GCGATG 1 cut(s) 38
BtsCI GGATG 3 cut(s) 34, 220, 483
BtsIMutI CAGTG 2 cut(s) 131, 147
Cfr13I GGNCC 1 cut(s) 246
ClaI ATCGAT 1 cut(s) 358
CviAII CATG 1 cut(s) 142
CviJI RGCY 3 cut(s) 290, 422, 455
CviKI_1 RGCY 3 cut(s) 290, 422, 455
DpnI GATC 2 cut(s) 357, 417
DpnII GATC 2 cut(s) 355, 415
Eco130I CCWWGG 1 cut(s) 250
Eco47I GGWCC 1 cut(s) 246
Eco57I CTGAAG 1 cut(s) 369
EcoO109I RGGNCCY 1 cut(s) 246
EcoRI GAATTC 1 cut(s) 4
EcoT14I CCWWGG 1 cut(s) 250
ErhI CCWWGG 1 cut(s) 250
FaeI CATG 1 cut(s) 145
FaiI YATR 8 cut(s) 77, 143, 168, 208, 296, 306, 315, 484
FatI CATG 1 cut(s) 141
Fnu4HI GCNGC 1 cut(s) 367
FokI GGATG 3 cut(s) 41, 227, 490
Fsp4HI GCNGC 1 cut(s) 367
FspBI CTAG 2 cut(s) 225, 419
GluI GCNGC 1 cut(s) 367
Hin1II CATG 1 cut(s) 145
HinfI GANTC 2 cut(s) 155, 182
HphI GGTGA 2 cut(s) 164, 386
Hpy188I TCNGA 2 cut(s) 160, 390
Hpy188III TCNNGA 4 cut(s) 14, 71, 244, 428
HpyAV CCTTC 3 cut(s) 92, 167, 344
HpyCH4V TGCA 3 cut(s) 141, 166, 366
HpyF10VI GCNNNNNNNGC 1 cut(s) 29
Hsp92II CATG 1 cut(s) 145
Kzo9I GATC 2 cut(s) 355, 415
LmnI GCTCC 1 cut(s) 282
LpnPI CCDG 4 cut(s) 56, 119, 135, 229
Lsp1109I GCAGC 1 cut(s) 378
LweI GCATC 2 cut(s) 19, 468
MaeI CTAG 2 cut(s) 225, 419
MaeIII GTNAC 2 cut(s) 307, 374
MalI GATC 2 cut(s) 357, 417
MboI GATC 2 cut(s) 355, 415
MboII GAAGA 2 cut(s) 443, 478
MflI RGATCY 1 cut(s) 415
MluCI AATT 1 cut(s) 4
MmeI TCCRAC 1 cut(s) 455
MnlI CCTC 4 cut(s) 31, 292, 406, 430
MroXI GAANNNNTTC 1 cut(s) 181
MwoI GCNNNNNNNGC 1 cut(s) 29
NdeII GATC 2 cut(s) 355, 415
NlaIII CATG 1 cut(s) 145
NlaIV GGNNCC 1 cut(s) 248
NmuCI GTSAC 2 cut(s) 307, 374
PdmI GAANNNNTTC 1 cut(s) 181
PfeI GAWTC 2 cut(s) 155, 182
PflFI GACNNNGTC 1 cut(s) 305
PkrI GCNGC 1 cut(s) 368
PpuMI RGGWCCY 1 cut(s) 246
Psp5II RGGWCCY 1 cut(s) 246
PspN4I GGNNCC 1 cut(s) 248
PspPI GGNCC 1 cut(s) 246
PspPPI RGGWCCY 1 cut(s) 246
PstI CTGCAG 1 cut(s) 368
PsuI RGATCY 1 cut(s) 415
PsyI GACNNNGTC 1 cut(s) 305
SatI GCNGC 1 cut(s) 367
Sau3AI GATC 2 cut(s) 355, 415
Sau96I GGNCC 1 cut(s) 246
SetI ASST 5 cut(s) 42, 70, 103, 292, 424
SfaNI GCATC 2 cut(s) 19, 468
SfcI CTRYAG 4 cut(s) 87, 192, 364, 456
SinI GGWCC 1 cut(s) 246
Sse9I AATT 1 cut(s) 4
SspI AATATT 1 cut(s) 331
SspMI CTAG 2 cut(s) 225, 419
StyI CCWWGG 1 cut(s) 250
TaqI TCGA 1 cut(s) 358
TasI AATT 1 cut(s) 4
TfiI GAWTC 2 cut(s) 155, 182
TscAI CASTG 2 cut(s) 138, 154
TseFI GTSAC 2 cut(s) 307, 374
TseI GCWGC 1 cut(s) 366
Tsp45I GTSAC 2 cut(s) 307, 374
TspDTI ATGAA 5 cut(s) 17, 158, 174, 213, 231
TspRI CASTG 2 cut(s) 138, 154
Tth111I GACNNNGTC 1 cut(s) 305
VpaK11BI GGWCC 1 cut(s) 246
XapI RAATTY 1 cut(s) 4
XmnI GAANNNNTTC 1 cut(s) 181
XspI CTAG 2 cut(s) 225, 419
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.