AT1G20600

BEST Arabidopsis thaliana protein match is AP2 B3-like transcriptional factor family protein (TAIR

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
1
OG0002989
Physical Location & Seq
Forward (+)
7133111 .. 7134454
1344 bp
Loading structure...
UTR
Exon/CDS
Intron
AT1G20600.1

Sequence Viewer

Length: 714 bp
ATGGCGAATTCAACAGGTAAACCGACAAGTTCAACACAAGAAGATGAAGAAGTTACATACATATTAGCACAATTGATGCAAGATGTTATGGATCGTGAAGAGGATATAGATGATGAAGACGATATAGATGATGAGGTTGCGTCCCTTCCATTATTACTAGTAAGCCAAGCTAATCAAAAGCAGTCTAGGAAGAGGGAAGAAAAAACTGAAAAAAATCAACCTAAGAGGGTTAAGAATCAGAACATCATGAAAATAAATATCCATGACTTTTCAGAAGAAACTCTGAGGTTAATTGAGGATTGGTACAACGCTGAACTCGATCCACAGGATATATTCGGCGATGATGAGGTGACGAGGCGATTCAGCCGACCGATAAAGAAGCAGTTGATGTCGAGCGACGTCGATACAGATCAAAGCAGGCTCATGTTATCGAAGGAGCAAGTGAAGGAGAAGATGCTTCCTTTTCTAGAAGAATCAGAGGATCCGGTAAAGGGGGTTGATGTTTCGGTGTATGGACCAGACGGGGAAGTTCAACAGATGAAGTTCAAGATGTGGAATGGGGATAAAACACCTGTCTTAACTTCAGGGTGGATGCAGTTTGTGGCAGATTATGGTCTTTTGAAGACTTCTGATTTTGTCACTGATGGTAAGGTATCACAGCTTGAGCATGTCTTCATTCGAGGCAGCAAAGTCAGGTGCTGCAACACTTCTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0005575 GO:0016020
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
B3 NAM

Protein Analysis

237

Amino Acids

27.28

Weight (kDa)

4.59

Isoelectric Point (pI)

51.07

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
B3 PF02362 127 - 214 3.7e-06 B3 DNA binding domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 402
AclWI GGATC 4 cut(s) 99, 314, 476, 489
AcsI RAATTY 1 cut(s) 7
AcuI CTGAAG 1 cut(s) 567
AcyI GRCGYC 1 cut(s) 399
AfaI GTAC 1 cut(s) 305
AfiI CCNNNNNNNGG 1 cut(s) 491
AgsI TTSAA 5 cut(s) 12, 33, 533, 547, 622
AhlI ACTAGT 1 cut(s) 157
AluBI AGCT 2 cut(s) 170, 661
AluI AGCT 2 cut(s) 170, 661
AlwI GGATC 4 cut(s) 99, 314, 476, 489
AlwNI CAGNNNCTG 1 cut(s) 699
ApeKI GCWGC 2 cut(s) 684, 699
ApoI RAATTY 1 cut(s) 7
AspS9I GGNCC 1 cut(s) 515
AsuHPI GGTGA 1 cut(s) 361
AvaII GGWCC 1 cut(s) 515
BamHI GGATCC 1 cut(s) 481
BbsI GAAGAC 3 cut(s) 123, 629, 664
BbvI GCAGC 2 cut(s) 686, 696
BccI CCATC 1 cut(s) 638
BcuI ACTAGT 1 cut(s) 157
BfaI CTAG 3 cut(s) 158, 186, 467
BisI GCNGC 2 cut(s) 685, 700
BlsI GCNGC 2 cut(s) 686, 701
Bme18I GGWCC 1 cut(s) 515
BmgT120I GGNCC 1 cut(s) 515
BmiI GGNNCC 1 cut(s) 483
BmsI GCATC 3 cut(s) 66, 444, 582
BpiI GAAGAC 3 cut(s) 123, 629, 664
BpuEI CTTGAG 1 cut(s) 683
BsaBI GATNNNNATC 1 cut(s) 408
BsaHI GRCGYC 1 cut(s) 399
BsaWI WCCGGW 1 cut(s) 484
Bsc4I CCNNNNNNNGG 1 cut(s) 491
Bse8I GATNNNNATC 1 cut(s) 408
BseGI GGATG 1 cut(s) 597
BseJI GATNNNNATC 1 cut(s) 408
BseLI CCNNNNNNNGG 1 cut(s) 491
BseMII CTCAG 1 cut(s) 275
BseXI GCAGC 2 cut(s) 686, 696
Bsh1285I CGRYCG 1 cut(s) 371
BsiEI CGRYCG 1 cut(s) 371
BsiSI CCGG 1 cut(s) 485
BslFI GGGAC 1 cut(s) 127
BslI CCNNNNNNNGG 1 cut(s) 491
BsmFI GGGAC 1 cut(s) 127
Bsp143I GATC 4 cut(s) 91, 319, 409, 481
BspCNI CTCAG 1 cut(s) 276
BspHI TCATGA 1 cut(s) 246
BspLI GGNNCC 1 cut(s) 483
BspPI GGATC 4 cut(s) 99, 314, 476, 489
BssMI GATC 4 cut(s) 91, 319, 409, 481
BssNI GRCGYC 1 cut(s) 399
Bst6I CTCTTC 2 cut(s) 93, 185
BstACI GRCGYC 1 cut(s) 399
BstC8I GCNNGC 1 cut(s) 419
BstDEI CTNAG 3 cut(s) 222, 284, 711
BstF5I GGATG 1 cut(s) 597
BstKTI GATC 4 cut(s) 94, 322, 412, 484
BstMBI GATC 4 cut(s) 91, 319, 409, 481
BstMCI CGRYCG 1 cut(s) 371
BstNSI RCATGY 1 cut(s) 671
BstV1I GCAGC 2 cut(s) 686, 696
BstV2I GAAGAC 3 cut(s) 123, 629, 664
BstX2I RGATCY 1 cut(s) 481
BstYI RGATCY 1 cut(s) 481
BtgZI GCGATG 1 cut(s) 354
BtsCI GGATG 1 cut(s) 597
BtsIMutI CAGTG 1 cut(s) 639
Cac8I GCNNGC 1 cut(s) 419
CaiI CAGNNNCTG 1 cut(s) 699
CciI TCATGA 1 cut(s) 246
Cfr13I GGNCC 1 cut(s) 515
CseI GACGC 1 cut(s) 129
Csp6I GTAC 1 cut(s) 304
CviAII CATG 4 cut(s) 247, 263, 424, 668
CviJI RGCY 5 cut(s) 165, 170, 366, 421, 661
CviKI_1 RGCY 5 cut(s) 165, 170, 366, 421, 661
CviQI GTAC 1 cut(s) 304
DdeI CTNAG 3 cut(s) 222, 284, 711
DpnI GATC 4 cut(s) 93, 321, 411, 483
DpnII GATC 4 cut(s) 91, 319, 409, 481
Eam1104I CTCTTC 2 cut(s) 93, 185
EarI CTCTTC 2 cut(s) 93, 185
Eco47I GGWCC 1 cut(s) 515
Eco57I CTGAAG 1 cut(s) 567
EcoRI GAATTC 1 cut(s) 7
FaeI CATG 4 cut(s) 250, 266, 427, 671
FaqI GGGAC 1 cut(s) 127
FatI CATG 4 cut(s) 246, 262, 423, 667
Fnu4HI GCNGC 2 cut(s) 685, 700
FokI GGATG 1 cut(s) 604
Fsp4HI GCNGC 2 cut(s) 685, 700
FspBI CTAG 3 cut(s) 158, 186, 467
GluI GCNGC 2 cut(s) 685, 700
HapII CCGG 1 cut(s) 485
HgaI GACGC 1 cut(s) 129
Hin1I GRCGYC 1 cut(s) 399
Hin1II CATG 4 cut(s) 250, 266, 427, 671
HinfI GANTC 3 cut(s) 235, 360, 473
HpaII CCGG 1 cut(s) 485
HphI GGTGA 1 cut(s) 361
Hpy166II GTNNAC 1 cut(s) 20
Hpy188I TCNGA 5 cut(s) 240, 274, 285, 478, 631
Hpy188III TCNNGA 4 cut(s) 95, 247, 467, 547
Hpy8I GTNNAC 1 cut(s) 20
Hpy99I CGWCG 2 cut(s) 401, 404
HpyAV CCTTC 3 cut(s) 155, 427, 439
HpyCH4IV ACGT 1 cut(s) 399
HpyCH4V TGCA 3 cut(s) 79, 595, 702
HpyF3I CTNAG 3 cut(s) 222, 284, 711
HpySE526I ACGT 1 cut(s) 399
Hsp92I GRCGYC 1 cut(s) 399
Hsp92II CATG 4 cut(s) 250, 266, 427, 671
Kzo9I GATC 4 cut(s) 91, 319, 409, 481
LmnI GCTCC 1 cut(s) 436
LpnPI CCDG 7 cut(s) 311, 403, 498, 531, 570, 585, 679
Lsp1109I GCAGC 2 cut(s) 686, 696
LweI GCATC 3 cut(s) 66, 444, 582
MaeI CTAG 3 cut(s) 158, 186, 467
MaeII ACGT 1 cut(s) 399
MaeIII GTNAC 3 cut(s) 52, 349, 637
MalI GATC 4 cut(s) 93, 321, 411, 483
MboI GATC 4 cut(s) 91, 319, 409, 481
MfeI CAATTG 1 cut(s) 71
MflI RGATCY 1 cut(s) 481
MluCI AATT 3 cut(s) 7, 71, 291
MseI TTAA 3 cut(s) 231, 290, 578
MspI CCGG 1 cut(s) 485
MunI CAATTG 1 cut(s) 71
NdeII GATC 4 cut(s) 91, 319, 409, 481
NlaIII CATG 4 cut(s) 250, 266, 427, 671
NlaIV GGNNCC 1 cut(s) 483
NmuCI GTSAC 2 cut(s) 349, 637
NspI RCATGY 1 cut(s) 671
PagI TCATGA 1 cut(s) 246
PcsI WCGNNNNNNNCGW 1 cut(s) 315
PfeI GAWTC 3 cut(s) 235, 360, 473
PkrI GCNGC 2 cut(s) 686, 701
PspN4I GGNNCC 1 cut(s) 483
PspPI GGNCC 1 cut(s) 515
PstNI CAGNNNCTG 1 cut(s) 699
PsuI RGATCY 1 cut(s) 481
RsaI GTAC 1 cut(s) 305
RsaNI GTAC 1 cut(s) 304
SaqAI TTAA 3 cut(s) 231, 290, 578
SatI GCNGC 2 cut(s) 685, 700
Sau3AI GATC 4 cut(s) 91, 319, 409, 481
Sau96I GGNCC 1 cut(s) 515
SfaNI GCATC 3 cut(s) 66, 444, 582
SinI GGWCC 1 cut(s) 515
SmlI CTYRAG 1 cut(s) 662
SmoI CTYRAG 1 cut(s) 662
SpeI ACTAGT 1 cut(s) 157
Sse9I AATT 3 cut(s) 7, 71, 291
SspMI CTAG 3 cut(s) 158, 186, 467
TaiI ACGT 1 cut(s) 402
TaqI TCGA 5 cut(s) 318, 392, 402, 431, 679
TaqII GACCGA 1 cut(s) 385
TasI AATT 3 cut(s) 7, 71, 291
TfiI GAWTC 3 cut(s) 235, 360, 473
Tru1I TTAA 3 cut(s) 231, 290, 578
Tru9I TTAA 3 cut(s) 231, 290, 578
TscAI CASTG 1 cut(s) 646
TseFI GTSAC 2 cut(s) 349, 637
TseI GCWGC 2 cut(s) 684, 699
Tsp45I GTSAC 2 cut(s) 349, 637
TspDTI ATGAA 5 cut(s) 60, 129, 263, 554, 664
TspRI CASTG 1 cut(s) 646
VpaK11BI GGWCC 1 cut(s) 515
XapI RAATTY 1 cut(s) 7
XbaI TCTAGA 1 cut(s) 466
XceI RCATGY 1 cut(s) 671
XspI CTAG 3 cut(s) 158, 186, 467
ZraI GACGTC 1 cut(s) 400
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.