AT2G17905

Domain of unknown function (DUF4283)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
2
OG0005646
Physical Location & Seq
Forward (+)
7777279 .. 7777805
527 bp
Loading structure...
UTR
Exon/CDS
Intron
AT2G17905.1

Sequence Viewer

Length: 519 bp
ATGGATAAAGACTTGGATAAAGCTATTCAAAACATGTCTCTTGAAGATAATCAACCTCTGATTCTCTCAAATCTTCCGCAGTTTTCCTCTATTGAACGCAATAGCTGTAGTATTCTGGGAAGATTCTTAAATCCAGAAAATCAACGGATGTCTAACTGGATTTTAGACATGCCTCGTATTTGGCGTTTATCTAATCGTGTTAGAGGTGTGGCTCTTTCGAAAGAGCGGTTTCAATTTTTCTTTAAATATGAGGAAGACTTAGAAGAAATCTTGAAGACTGGAGTGTGGACACAAGATGATTGGGCAGTTGTTATGCAAAAATGGATAGAGAAACCACCTGATGACTATCTGAGGTTTCTCCCAATTTGGGTTAGAATCAGAAATATTCCCGTTAACTATTATACTGAAGACACGATTAAGGAGATTGCGGGATGTTTAGGGAAAGTGATGCAGGTTGTCATGGATCCTGAAAAATCACAGGTTCAAGATTATGTTCGAGTTCAGTTCTATTTTCTGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF4283 zf-CCHC_4

Protein Analysis

172

Amino Acids

20.6

Weight (kDa)

5.14

Isoelectric Point (pI)

46.15

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF4283 PF14111 31 - 108 6.8e-15 Domain of unknown function (DUF4283)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 442
AccBSI CCGCTC 1 cut(s) 226
AciI CCGC 3 cut(s) 77, 226, 428
AclWI GGATC 2 cut(s) 458, 471
AcuI CTGAAG 1 cut(s) 426
AfiI CCNNNNNNNGG 1 cut(s) 367
AflIII ACRYGT 1 cut(s) 33
AgsI TTSAA 6 cut(s) 29, 44, 95, 233, 274, 485
AluBI AGCT 2 cut(s) 23, 105
AluI AGCT 2 cut(s) 23, 105
Alw26I GTCTC 1 cut(s) 42
AlwI GGATC 2 cut(s) 458, 471
AsuII TTCGAA 1 cut(s) 218
BamHI GGATCC 1 cut(s) 463
BbsI GAAGAC 3 cut(s) 261, 281, 414
BcoDI GTCTC 1 cut(s) 42
BfmI CTRYAG 2 cut(s) 106, 515
BfuAI ACCTGC 1 cut(s) 442
BmiI GGNNCC 1 cut(s) 465
BmsI GCATC 1 cut(s) 438
BpiI GAAGAC 3 cut(s) 261, 281, 414
BpmI CTGGAG 1 cut(s) 300
Bpu14I TTCGAA 1 cut(s) 218
BsaBI GATNNNNATC 1 cut(s) 345
Bsc4I CCNNNNNNNGG 1 cut(s) 367
Bse1I ACTGG 2 cut(s) 161, 283
Bse8I GATNNNNATC 1 cut(s) 345
BseGI GGATG 2 cut(s) 153, 437
BseJI GATNNNNATC 1 cut(s) 345
BseLI CCNNNNNNNGG 1 cut(s) 367
BseMII CTCAG 1 cut(s) 341
BseNI ACTGG 2 cut(s) 161, 283
BslI CCNNNNNNNGG 1 cut(s) 367
BsmAI GTCTC 1 cut(s) 42
Bsp119I TTCGAA 1 cut(s) 218
Bsp143I GATC 1 cut(s) 463
BspACI CCGC 3 cut(s) 77, 226, 428
BspCNI CTCAG 1 cut(s) 342
BspLI GGNNCC 1 cut(s) 465
BspMI ACCTGC 1 cut(s) 442
BspPI GGATC 2 cut(s) 458, 471
BspT104I TTCGAA 1 cut(s) 218
BsrBI CCGCTC 1 cut(s) 226
BsrI ACTGG 2 cut(s) 161, 283
BssMI GATC 1 cut(s) 463
BstBI TTCGAA 1 cut(s) 218
BstDEI CTNAG 2 cut(s) 259, 350
BstF5I GGATG 2 cut(s) 153, 437
BstKTI GATC 1 cut(s) 466
BstMAI GTCTC 1 cut(s) 42
BstMBI GATC 1 cut(s) 463
BstNSI RCATGY 2 cut(s) 37, 172
BstSFI CTRYAG 2 cut(s) 106, 515
BstV2I GAAGAC 3 cut(s) 261, 281, 414
BstX2I RGATCY 1 cut(s) 463
BstYI RGATCY 1 cut(s) 463
BtsCI GGATG 2 cut(s) 153, 437
BveI ACCTGC 1 cut(s) 442
CviAII CATG 3 cut(s) 34, 169, 460
CviJI RGCY 3 cut(s) 23, 105, 212
CviKI_1 RGCY 3 cut(s) 23, 105, 212
DdeI CTNAG 2 cut(s) 259, 350
DpnI GATC 1 cut(s) 465
DpnII GATC 1 cut(s) 463
DraI TTTAAA 1 cut(s) 244
Eco57I CTGAAG 1 cut(s) 426
FaeI CATG 3 cut(s) 37, 172, 463
FaiI YATR 7 cut(s) 35, 170, 249, 314, 402, 461, 492
FatI CATG 3 cut(s) 33, 168, 459
FauI CCCGC 1 cut(s) 421
FokI GGATG 2 cut(s) 160, 444
GsuI CTGGAG 1 cut(s) 300
Hin1II CATG 3 cut(s) 37, 172, 463
HincII GTYRAC 1 cut(s) 394
HindII GTYRAC 1 cut(s) 394
HinfI GANTC 3 cut(s) 61, 123, 375
HpaI GTTAAC 1 cut(s) 394
Hpy166II GTNNAC 2 cut(s) 288, 394
Hpy188I TCNGA 3 cut(s) 60, 351, 380
Hpy188III TCNNGA 5 cut(s) 41, 134, 271, 467, 485
Hpy8I GTNNAC 2 cut(s) 288, 394
HpyCH4V TGCA 2 cut(s) 316, 451
HpyF3I CTNAG 2 cut(s) 259, 350
Hsp92II CATG 3 cut(s) 37, 172, 463
KspAI GTTAAC 1 cut(s) 394
Kzo9I GATC 1 cut(s) 463
LpnPI CCDG 8 cut(s) 101, 142, 147, 264, 351, 437, 464, 480
LweI GCATC 1 cut(s) 438
MalI GATC 1 cut(s) 465
MbiI CCGCTC 1 cut(s) 226
MboI GATC 1 cut(s) 463
MboII GAAGA 7 cut(s) 56, 65, 132, 266, 275, 286, 419
MflI RGATCY 1 cut(s) 463
MluCI AATT 2 cut(s) 233, 363
MnlI CCTC 6 cut(s) 66, 97, 183, 197, 244, 345
MseI TTAA 4 cut(s) 128, 243, 393, 417
NdeII GATC 1 cut(s) 463
NlaIII CATG 3 cut(s) 37, 172, 463
NlaIV GGNNCC 1 cut(s) 465
NspI RCATGY 2 cut(s) 37, 172
NspV TTCGAA 1 cut(s) 218
PciI ACATGT 1 cut(s) 33
PcsI WCGNNNNNNNCGW 1 cut(s) 181
PfeI GAWTC 3 cut(s) 61, 123, 375
PscI ACATGT 1 cut(s) 33
PspN4I GGNNCC 1 cut(s) 465
PsuI RGATCY 1 cut(s) 463
SaqAI TTAA 4 cut(s) 128, 243, 393, 417
Sau3AI GATC 1 cut(s) 463
SetI ASST 8 cut(s) 25, 58, 107, 208, 340, 356, 456, 483
SfaNI GCATC 1 cut(s) 438
SfcI CTRYAG 2 cut(s) 106, 515
SfuI TTCGAA 1 cut(s) 218
Sse9I AATT 2 cut(s) 233, 363
SsiI CCGC 3 cut(s) 77, 226, 428
SspI AATATT 1 cut(s) 385
TaqI TCGA 2 cut(s) 218, 496
TasI AATT 2 cut(s) 233, 363
TfiI GAWTC 3 cut(s) 61, 123, 375
Tru1I TTAA 4 cut(s) 128, 243, 393, 417
Tru9I TTAA 4 cut(s) 128, 243, 393, 417
TspGWI ACGGA 1 cut(s) 160
XceI RCATGY 2 cut(s) 37, 172
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.